ID: 1059271270

View in Genome Browser
Species Human (GRCh38)
Location 9:113071646-113071668
Sequence CAGGAACCCGGGCCCCCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059271270_1059271279 7 Left 1059271270 9:113071646-113071668 CCACCGGGGGGCCCGGGTTCCTG No data
Right 1059271279 9:113071676-113071698 GAGGGCTTCCTCGGCCCCCTCGG No data
1059271270_1059271281 9 Left 1059271270 9:113071646-113071668 CCACCGGGGGGCCCGGGTTCCTG No data
Right 1059271281 9:113071678-113071700 GGGCTTCCTCGGCCCCCTCGGGG No data
1059271270_1059271278 -2 Left 1059271270 9:113071646-113071668 CCACCGGGGGGCCCGGGTTCCTG No data
Right 1059271278 9:113071667-113071689 TGGCGCACTGAGGGCTTCCTCGG No data
1059271270_1059271280 8 Left 1059271270 9:113071646-113071668 CCACCGGGGGGCCCGGGTTCCTG No data
Right 1059271280 9:113071677-113071699 AGGGCTTCCTCGGCCCCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059271270 Original CRISPR CAGGAACCCGGGCCCCCCGG TGG (reversed) Intergenic
No off target data available for this crispr