ID: 1059271598

View in Genome Browser
Species Human (GRCh38)
Location 9:113072932-113072954
Sequence CACACACGCAGGTGCACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059271598_1059271603 27 Left 1059271598 9:113072932-113072954 CCTGGTGTGCACCTGCGTGTGTG No data
Right 1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG No data
1059271598_1059271602 26 Left 1059271598 9:113072932-113072954 CCTGGTGTGCACCTGCGTGTGTG No data
Right 1059271602 9:113072981-113073003 TGTGCGCGCGCGCGCGTGCTGGG No data
1059271598_1059271601 25 Left 1059271598 9:113072932-113072954 CCTGGTGTGCACCTGCGTGTGTG No data
Right 1059271601 9:113072980-113073002 GTGTGCGCGCGCGCGCGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059271598 Original CRISPR CACACACGCAGGTGCACACC AGG (reversed) Intergenic