ID: 1059271600

View in Genome Browser
Species Human (GRCh38)
Location 9:113072959-113072981
Sequence ACACACACACACACACACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059271600_1059271602 -1 Left 1059271600 9:113072959-113072981 CCTGTGTGTGTGTGTGTGTGTGT No data
Right 1059271602 9:113072981-113073003 TGTGCGCGCGCGCGCGTGCTGGG No data
1059271600_1059271605 27 Left 1059271600 9:113072959-113072981 CCTGTGTGTGTGTGTGTGTGTGT No data
Right 1059271605 9:113073009-113073031 TGCACACTATGCCGAGAGTCGGG No data
1059271600_1059271604 26 Left 1059271600 9:113072959-113072981 CCTGTGTGTGTGTGTGTGTGTGT No data
Right 1059271604 9:113073008-113073030 GTGCACACTATGCCGAGAGTCGG No data
1059271600_1059271603 0 Left 1059271600 9:113072959-113072981 CCTGTGTGTGTGTGTGTGTGTGT No data
Right 1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG No data
1059271600_1059271601 -2 Left 1059271600 9:113072959-113072981 CCTGTGTGTGTGTGTGTGTGTGT No data
Right 1059271601 9:113072980-113073002 GTGTGCGCGCGCGCGCGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059271600 Original CRISPR ACACACACACACACACACAC AGG (reversed) Intergenic