ID: 1059271602

View in Genome Browser
Species Human (GRCh38)
Location 9:113072981-113073003
Sequence TGTGCGCGCGCGCGCGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059271598_1059271602 26 Left 1059271598 9:113072932-113072954 CCTGGTGTGCACCTGCGTGTGTG No data
Right 1059271602 9:113072981-113073003 TGTGCGCGCGCGCGCGTGCTGGG No data
1059271599_1059271602 15 Left 1059271599 9:113072943-113072965 CCTGCGTGTGTGCGTGCCTGTGT No data
Right 1059271602 9:113072981-113073003 TGTGCGCGCGCGCGCGTGCTGGG No data
1059271600_1059271602 -1 Left 1059271600 9:113072959-113072981 CCTGTGTGTGTGTGTGTGTGTGT No data
Right 1059271602 9:113072981-113073003 TGTGCGCGCGCGCGCGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059271602 Original CRISPR TGTGCGCGCGCGCGCGTGCT GGG Intergenic