ID: 1059271603

View in Genome Browser
Species Human (GRCh38)
Location 9:113072982-113073004
Sequence GTGCGCGCGCGCGCGTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059271598_1059271603 27 Left 1059271598 9:113072932-113072954 CCTGGTGTGCACCTGCGTGTGTG No data
Right 1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG No data
1059271600_1059271603 0 Left 1059271600 9:113072959-113072981 CCTGTGTGTGTGTGTGTGTGTGT 0: 1491
1: 2524
2: 3655
3: 5497
4: 10599
Right 1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG No data
1059271599_1059271603 16 Left 1059271599 9:113072943-113072965 CCTGCGTGTGTGCGTGCCTGTGT No data
Right 1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059271603 Original CRISPR GTGCGCGCGCGCGCGTGCTG GGG Intergenic
No off target data available for this crispr