ID: 1059271605

View in Genome Browser
Species Human (GRCh38)
Location 9:113073009-113073031
Sequence TGCACACTATGCCGAGAGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059271600_1059271605 27 Left 1059271600 9:113072959-113072981 CCTGTGTGTGTGTGTGTGTGTGT No data
Right 1059271605 9:113073009-113073031 TGCACACTATGCCGAGAGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059271605 Original CRISPR TGCACACTATGCCGAGAGTC GGG Intergenic