ID: 1059273868

View in Genome Browser
Species Human (GRCh38)
Location 9:113083868-113083890
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059273865_1059273868 0 Left 1059273865 9:113083845-113083867 CCTGTGTGTGTGTGTGTGTGTGT No data
Right 1059273868 9:113083868-113083890 GTGCGCGCGCGCGCGTGCTGGGG No data
1059273863_1059273868 27 Left 1059273863 9:113083818-113083840 CCTGGTGTGCACCTGCGTGTGTG No data
Right 1059273868 9:113083868-113083890 GTGCGCGCGCGCGCGTGCTGGGG No data
1059273864_1059273868 16 Left 1059273864 9:113083829-113083851 CCTGCGTGTGTGCGTGCCTGTGT No data
Right 1059273868 9:113083868-113083890 GTGCGCGCGCGCGCGTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059273868 Original CRISPR GTGCGCGCGCGCGCGTGCTG GGG Intergenic