ID: 1059275001

View in Genome Browser
Species Human (GRCh38)
Location 9:113089312-113089334
Sequence GTGCGCGCGCGCGCGTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059274996_1059275001 25 Left 1059274996 9:113089264-113089286 CCTGGTGTGCACCTGCGTGTGTG No data
Right 1059275001 9:113089312-113089334 GTGCGCGCGCGCGCGTGCTGGGG No data
1059274998_1059275001 -2 Left 1059274998 9:113089291-113089313 CCTGTGTGTGTGTGTGTGTGTGT 0: 1491
1: 2524
2: 3655
3: 5497
4: 10599
Right 1059275001 9:113089312-113089334 GTGCGCGCGCGCGCGTGCTGGGG No data
1059274997_1059275001 14 Left 1059274997 9:113089275-113089297 CCTGCGTGTGTGCGTGCCTGTGT No data
Right 1059275001 9:113089312-113089334 GTGCGCGCGCGCGCGTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059275001 Original CRISPR GTGCGCGCGCGCGCGTGCTG GGG Intergenic
No off target data available for this crispr