ID: 1059277050

View in Genome Browser
Species Human (GRCh38)
Location 9:113106319-113106341
Sequence TGCACACAGTGTCACCTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059277050_1059277062 27 Left 1059277050 9:113106319-113106341 CCACAGAGGTGACACTGTGTGCA No data
Right 1059277062 9:113106369-113106391 CTTTGTTTCCTGTGCCCCCAGGG No data
1059277050_1059277057 -9 Left 1059277050 9:113106319-113106341 CCACAGAGGTGACACTGTGTGCA No data
Right 1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG No data
1059277050_1059277056 -10 Left 1059277050 9:113106319-113106341 CCACAGAGGTGACACTGTGTGCA No data
Right 1059277056 9:113106332-113106354 ACTGTGTGCAGGGAGGGGAGAGG No data
1059277050_1059277061 26 Left 1059277050 9:113106319-113106341 CCACAGAGGTGACACTGTGTGCA No data
Right 1059277061 9:113106368-113106390 GCTTTGTTTCCTGTGCCCCCAGG No data
1059277050_1059277058 -8 Left 1059277050 9:113106319-113106341 CCACAGAGGTGACACTGTGTGCA No data
Right 1059277058 9:113106334-113106356 TGTGTGCAGGGAGGGGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059277050 Original CRISPR TGCACACAGTGTCACCTCTG TGG (reversed) Intergenic
No off target data available for this crispr