ID: 1059277057

View in Genome Browser
Species Human (GRCh38)
Location 9:113106333-113106355
Sequence CTGTGTGCAGGGAGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059277049_1059277057 -6 Left 1059277049 9:113106316-113106338 CCACCACAGAGGTGACACTGTGT No data
Right 1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG No data
1059277045_1059277057 20 Left 1059277045 9:113106290-113106312 CCTGTGAACTGAGGCGGACGACA No data
Right 1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG No data
1059277050_1059277057 -9 Left 1059277050 9:113106319-113106341 CCACAGAGGTGACACTGTGTGCA No data
Right 1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059277057 Original CRISPR CTGTGTGCAGGGAGGGGAGA GGG Intergenic
No off target data available for this crispr