ID: 1059279194

View in Genome Browser
Species Human (GRCh38)
Location 9:113118218-113118240
Sequence CTGTGTGCAGGGAGGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059279194_1059279202 -6 Left 1059279194 9:113118218-113118240 CCCTCTCCCCTCCCTGCACACAG No data
Right 1059279202 9:113118235-113118257 ACACAGTGTCACCTCTGTGGTGG No data
1059279194_1059279201 -9 Left 1059279194 9:113118218-113118240 CCCTCTCCCCTCCCTGCACACAG No data
Right 1059279201 9:113118232-113118254 TGCACACAGTGTCACCTCTGTGG No data
1059279194_1059279206 20 Left 1059279194 9:113118218-113118240 CCCTCTCCCCTCCCTGCACACAG No data
Right 1059279206 9:113118261-113118283 TGTCGTCCGCCTCAGTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059279194 Original CRISPR CTGTGTGCAGGGAGGGGAGA GGG (reversed) Intergenic
No off target data available for this crispr