ID: 1059280061

View in Genome Browser
Species Human (GRCh38)
Location 9:113125245-113125267
Sequence GCCACTACAACCACCTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059280061_1059280066 24 Left 1059280061 9:113125245-113125267 CCACCAAAGGTGGTTGTAGTGGC No data
Right 1059280066 9:113125292-113125314 TAGACCTGCCTCCCTTGGATTGG No data
1059280061_1059280065 19 Left 1059280061 9:113125245-113125267 CCACCAAAGGTGGTTGTAGTGGC No data
Right 1059280065 9:113125287-113125309 AGTCATAGACCTGCCTCCCTTGG No data
1059280061_1059280068 26 Left 1059280061 9:113125245-113125267 CCACCAAAGGTGGTTGTAGTGGC No data
Right 1059280068 9:113125294-113125316 GACCTGCCTCCCTTGGATTGGGG No data
1059280061_1059280067 25 Left 1059280061 9:113125245-113125267 CCACCAAAGGTGGTTGTAGTGGC No data
Right 1059280067 9:113125293-113125315 AGACCTGCCTCCCTTGGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059280061 Original CRISPR GCCACTACAACCACCTTTGG TGG (reversed) Intergenic
No off target data available for this crispr