ID: 1059280155

View in Genome Browser
Species Human (GRCh38)
Location 9:113126046-113126068
Sequence AAGCTCCCTTAATACTTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059280155_1059280156 -7 Left 1059280155 9:113126046-113126068 CCTTTGAAGTATTAAGGGAGCTT No data
Right 1059280156 9:113126062-113126084 GGAGCTTCCTTAATCCTACCTGG No data
1059280155_1059280160 12 Left 1059280155 9:113126046-113126068 CCTTTGAAGTATTAAGGGAGCTT No data
Right 1059280160 9:113126081-113126103 CTGGACAGTGAAGATCTCTGAGG No data
1059280155_1059280161 19 Left 1059280155 9:113126046-113126068 CCTTTGAAGTATTAAGGGAGCTT No data
Right 1059280161 9:113126088-113126110 GTGAAGATCTCTGAGGCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059280155 Original CRISPR AAGCTCCCTTAATACTTCAA AGG (reversed) Intergenic
No off target data available for this crispr