ID: 1059280160

View in Genome Browser
Species Human (GRCh38)
Location 9:113126081-113126103
Sequence CTGGACAGTGAAGATCTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059280155_1059280160 12 Left 1059280155 9:113126046-113126068 CCTTTGAAGTATTAAGGGAGCTT No data
Right 1059280160 9:113126081-113126103 CTGGACAGTGAAGATCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059280160 Original CRISPR CTGGACAGTGAAGATCTCTG AGG Intergenic
No off target data available for this crispr