ID: 1059281117

View in Genome Browser
Species Human (GRCh38)
Location 9:113135064-113135086
Sequence GCACTGATGCTGCTGGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059281117_1059281124 19 Left 1059281117 9:113135064-113135086 CCAGGGACCAGCAGCATCAGTGC No data
Right 1059281124 9:113135106-113135128 ACTCAGCACACACAATTATCAGG No data
1059281117_1059281120 -6 Left 1059281117 9:113135064-113135086 CCAGGGACCAGCAGCATCAGTGC No data
Right 1059281120 9:113135081-113135103 CAGTGCCCAGCAGACTAGGCAGG No data
1059281117_1059281119 -10 Left 1059281117 9:113135064-113135086 CCAGGGACCAGCAGCATCAGTGC No data
Right 1059281119 9:113135077-113135099 GCATCAGTGCCCAGCAGACTAGG No data
1059281117_1059281125 27 Left 1059281117 9:113135064-113135086 CCAGGGACCAGCAGCATCAGTGC No data
Right 1059281125 9:113135114-113135136 CACACAATTATCAGGCCCCTAGG No data
1059281117_1059281121 -5 Left 1059281117 9:113135064-113135086 CCAGGGACCAGCAGCATCAGTGC No data
Right 1059281121 9:113135082-113135104 AGTGCCCAGCAGACTAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059281117 Original CRISPR GCACTGATGCTGCTGGTCCC TGG (reversed) Intergenic
No off target data available for this crispr