ID: 1059282801

View in Genome Browser
Species Human (GRCh38)
Location 9:113149271-113149293
Sequence GCACTCCTTCCCTGTCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059282801_1059282805 5 Left 1059282801 9:113149271-113149293 CCTGGGGGACAGGGAAGGAGTGC No data
Right 1059282805 9:113149299-113149321 GTGGTACAGAAAGAAATTTTAGG No data
1059282801_1059282806 14 Left 1059282801 9:113149271-113149293 CCTGGGGGACAGGGAAGGAGTGC No data
Right 1059282806 9:113149308-113149330 AAAGAAATTTTAGGACTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059282801 Original CRISPR GCACTCCTTCCCTGTCCCCC AGG (reversed) Intergenic
No off target data available for this crispr