ID: 1059284017

View in Genome Browser
Species Human (GRCh38)
Location 9:113157457-113157479
Sequence CTCACTGGACCAACTGGCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059284017_1059284024 10 Left 1059284017 9:113157457-113157479 CCCGAGCCAGTTGGTCCAGTGAG 0: 1
1: 0
2: 0
3: 7
4: 186
Right 1059284024 9:113157490-113157512 CCCACACCTCTATTCTCATATGG No data
1059284017_1059284027 17 Left 1059284017 9:113157457-113157479 CCCGAGCCAGTTGGTCCAGTGAG 0: 1
1: 0
2: 0
3: 7
4: 186
Right 1059284027 9:113157497-113157519 CTCTATTCTCATATGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059284017 Original CRISPR CTCACTGGACCAACTGGCTC GGG (reversed) Intronic
900310542 1:2031318-2031340 CCCACTGGACCAAAGGCCTCAGG - Intergenic
904333686 1:29783845-29783867 CTCACTGGCCCCACGGGCTCAGG + Intergenic
905169011 1:36098971-36098993 CTCCCTGGTCCAGCTGGCTTAGG - Exonic
906457416 1:46009126-46009148 CTCACTGCACCCTCTGCCTCCGG + Intronic
907441157 1:54479320-54479342 CTCTCTGGACCAAAGGGCTTAGG - Intergenic
907969270 1:59364982-59365004 GTAACTGGATCAACTGGCACTGG + Intronic
913014051 1:114715100-114715122 CTCACTGCACCCTCTGCCTCTGG + Intronic
914341704 1:146765582-146765604 CTCACTGCACCCACTGTCTCTGG - Intergenic
914840510 1:151244580-151244602 CTCACTGCAACCACTGCCTCCGG - Intronic
917756241 1:178101679-178101701 CTCATTGAAGAAACTGGCTCAGG + Intronic
920534353 1:206728071-206728093 CTCCCTGGACCAATTGGCTAGGG - Intronic
922041776 1:221904199-221904221 CTCACTTGCCCAACAGACTCAGG - Intergenic
923608478 1:235467556-235467578 CTCACTGCAACATCTGCCTCGGG + Intronic
1062823342 10:550949-550971 CTCACTGGACACTGTGGCTCTGG + Intronic
1062823359 10:551031-551053 CTCACTGGACACTGTGGCTCTGG + Intronic
1063062939 10:2577239-2577261 CTCTCTGGACAAACTGCCTGTGG + Intergenic
1064180821 10:13113093-13113115 CTCACTGCACCCTCTGCCTCCGG + Intronic
1064986203 10:21212667-21212689 CTCACTGAAGGACCTGGCTCAGG - Intergenic
1068248808 10:54409165-54409187 CTCACAGGTCCACCTGGCTGGGG - Intronic
1069444047 10:68456639-68456661 GGCACTGTATCAACTGGCTCAGG - Intronic
1069944732 10:71978077-71978099 CACACTGTACAAAGTGGCTCAGG + Intronic
1070555823 10:77527220-77527242 CCCACAGGACGAACTGGCTTGGG + Intronic
1072012291 10:91313201-91313223 ATAACTGGACCAATTGCCTCTGG + Intergenic
1075052167 10:119190587-119190609 CTCACTTGACAAACTTGCTCTGG - Intergenic
1075179739 10:120199574-120199596 CTCACTGCAACATCTGCCTCTGG + Intergenic
1078201948 11:9191310-9191332 CTCACTGCAACCTCTGGCTCCGG + Intronic
1080654160 11:34245521-34245543 CTCACCAGACTAACTGGGTCTGG + Intronic
1081075277 11:38665987-38666009 CTCACTGCACCCTCTGCCTCTGG + Intergenic
1081904274 11:46657353-46657375 CGTTCTGGACAAACTGGCTCTGG - Intronic
1081956901 11:47100714-47100736 CTCACTGCAACATCTGCCTCTGG - Intronic
1084104753 11:66974159-66974181 CTCTGAGGACCAACTGCCTCTGG - Intergenic
1085220057 11:74865859-74865881 CTTTCTGGCCCAAATGGCTCTGG - Intronic
1086962280 11:92990521-92990543 CTCACTGCAACATCTGCCTCCGG - Intergenic
1087818941 11:102689453-102689475 CTCACTGCAACATCTGCCTCCGG - Intergenic
1088635185 11:111812841-111812863 CTCACTGCAGCCACTGCCTCCGG - Intronic
1088666934 11:112102567-112102589 CTCACTGGAACCTCTGCCTCTGG + Intronic
1088832295 11:113547668-113547690 CCCACTTGTCCTACTGGCTCTGG + Intergenic
1090368146 11:126225472-126225494 CTCACTGGAGAAACTGGGTGTGG - Intronic
1093456921 12:19373592-19373614 CTCACTGCAACCACTGCCTCTGG - Intronic
1097463518 12:59893162-59893184 CTCACAGGAACAACTGGTTTTGG + Intergenic
1098258652 12:68644917-68644939 ATCACTGGACCAGCTGGACCAGG - Intronic
1098899100 12:76094472-76094494 CTCACTGGAACCTCTGCCTCCGG + Intergenic
1100161537 12:91866458-91866480 CTCACTGAAGGAACTGACTCAGG + Intergenic
1101853793 12:108425528-108425550 CTCACAGGACAAACAGACTCAGG + Intergenic
1102284858 12:111647819-111647841 CTCACTGCAACATCTGCCTCCGG - Intronic
1102490488 12:113287288-113287310 CTCACTGCACCAGGTGCCTCTGG + Intronic
1103566631 12:121819434-121819456 CTCACTGGACGACGTGGCTTCGG - Exonic
1105494710 13:20920413-20920435 CTCACTGCAACATCTGCCTCCGG - Intergenic
1106129319 13:26926467-26926489 CTCACTGGGCAACCAGGCTCTGG - Intergenic
1107488814 13:40859855-40859877 CTCACTGGTCTCACTGGCCCAGG - Intergenic
1107488965 13:40861502-40861524 CTCACTGGTCTCACTGGCCCAGG - Intergenic
1108216876 13:48194205-48194227 CTCACTGCAACCTCTGGCTCTGG + Intergenic
1108629137 13:52263896-52263918 CTCACTGGTCTCACTGGCCCAGG - Intergenic
1108656919 13:52542580-52542602 CTCACTGGTCTCACTGGCCCAGG + Intergenic
1109249916 13:60007123-60007145 CTCACTGCAACCACTGTCTCCGG + Intronic
1109347991 13:61140567-61140589 CTCACTGCAACATCTGCCTCCGG + Intergenic
1118318846 14:64741810-64741832 CCCACTGGAGGTACTGGCTCTGG - Exonic
1118769572 14:68933205-68933227 CTCACTGCAACATCTGCCTCAGG + Intronic
1119237178 14:73029442-73029464 CTCACTGGAACCTCTGCCTCTGG - Intergenic
1119564171 14:75614744-75614766 CTCACTGCTCCAAATGGCTAGGG + Intronic
1121091207 14:91184026-91184048 CCCACTGGCCCACCTGACTCTGG - Intronic
1121568131 14:94925899-94925921 ATCCCTGGTCCAACTGGCTGAGG - Intergenic
1124460316 15:29884283-29884305 CTCCCTGGACCATCTGTATCAGG + Intronic
1126115626 15:45204967-45204989 GCCACTGGACCAGCAGGCTCTGG + Intergenic
1128122132 15:65158574-65158596 CTGCTTGGACCAACTGGGTCAGG - Exonic
1128200215 15:65798917-65798939 CTCACTGCAACATCTGCCTCTGG + Intronic
1129386845 15:75201143-75201165 CTCCCTGGACCATCTGACTGTGG - Intronic
1130586028 15:85183230-85183252 CTCACTGGACCCTCAGTCTCTGG + Intergenic
1131260662 15:90885871-90885893 CACACTGTGCCATCTGGCTCTGG + Intronic
1133589179 16:7226204-7226226 CTGACTTGAGTAACTGGCTCAGG - Intronic
1135031902 16:19045226-19045248 CTCACTGGAGCCACAGGATCTGG + Intronic
1136079639 16:27843290-27843312 CGCTCTGGACCATGTGGCTCAGG + Intronic
1137428911 16:48402511-48402533 CTCACTGCAACCTCTGGCTCCGG + Intronic
1138547340 16:57727708-57727730 CTCACTGGGGCCACTGGCCCAGG - Intronic
1139196531 16:64925317-64925339 CACACTGTCCCAACAGGCTCTGG + Intergenic
1139656194 16:68388477-68388499 CACACAGGCCCAAATGGCTCAGG - Intronic
1139992574 16:70951860-70951882 CTCACTGCACCCACTGTCTCTGG + Intronic
1141716284 16:85728945-85728967 CCCACTGGATCAACTGAGTCAGG - Intronic
1146128850 17:30252576-30252598 CTCACTGAAACCACAGGCTCAGG - Intronic
1146134675 17:30308809-30308831 CTCACTGGAACCTCTGCCTCCGG + Intergenic
1146497031 17:33331961-33331983 TTCCCTGGACCAACTGAATCAGG + Intronic
1146972458 17:37083801-37083823 CTTTCTGGAACATCTGGCTCAGG + Intergenic
1148954723 17:51344216-51344238 CTCACTGCAACATCTGCCTCCGG + Intergenic
1155348554 18:24883508-24883530 CTCAATGGACCAGCTGGGCCAGG + Intergenic
1156151449 18:34248935-34248957 CTCACAGTTCCAACTGGCTGGGG + Intergenic
1157595938 18:48863618-48863640 CTCATTTGACCAACTGGGACTGG - Intergenic
1159777998 18:72626025-72626047 CTCACTGGACCACAAGGCTGGGG - Intronic
1159784145 18:72693773-72693795 CTCACTGCAACATCTGCCTCCGG - Intergenic
1164019012 19:21280589-21280611 CTCACTGCAACATCTGCCTCCGG + Intronic
1165211206 19:34237180-34237202 CTCACTGCAACATCTGCCTCCGG - Intergenic
1165932116 19:39366240-39366262 CTCACTGGAACCTCTGCCTCTGG - Intronic
1165967189 19:39592345-39592367 CTCACTGCAACAACTGCCTTCGG - Intergenic
1165968029 19:39600932-39600954 CTCACTGTAACCTCTGGCTCCGG - Intergenic
925655122 2:6138539-6138561 CTCACTGCAACCACTGCCTCTGG - Intergenic
927113966 2:19884121-19884143 AGCACTTGACCATCTGGCTCTGG + Intergenic
930730627 2:54724757-54724779 CTCACTGCACCTGCGGGCTCCGG - Exonic
934890747 2:98066946-98066968 CTGAGTGGCCCAAGTGGCTCAGG + Intergenic
934996381 2:98965162-98965184 AACACTGGACCAAATGGATCTGG - Intergenic
938712838 2:133990365-133990387 CTATGTGGACCAACTGGGTCAGG + Intergenic
939720932 2:145650295-145650317 ATCACTGGAGCAACAGGATCAGG + Intergenic
939928942 2:148208022-148208044 CACACTGGACCCACTGGATTTGG - Intronic
940289559 2:152065307-152065329 CTCACTGCAACCTCTGGCTCCGG - Intronic
940295917 2:152123829-152123851 CTCAGTGGACCAATTTGATCGGG + Exonic
945048501 2:205802039-205802061 CTCACTAGACCAGCAGGCCCTGG + Intergenic
947476783 2:230457314-230457336 CAAACTGGACCAAGTGGCACTGG - Intronic
949052960 2:241907283-241907305 CACACAGGTCCACCTGGCTCTGG - Intergenic
1172163978 20:32887499-32887521 CTCACTGGAACCTCTGCCTCCGG - Intronic
1174427009 20:50439037-50439059 CTCAGGGGACCGACAGGCTCGGG - Intergenic
1174570791 20:51499666-51499688 CTCACTGCAACATCTGCCTCCGG - Intronic
1175628574 20:60511301-60511323 CTCAAGGGATAAACTGGCTCAGG + Intergenic
1178711546 21:34921704-34921726 CTCACTGCACCCTCTGCCTCCGG + Intronic
1179610937 21:42549464-42549486 TTCTCTGGACCACCTGCCTCAGG - Intronic
1180099656 21:45578644-45578666 CTCTTTGTACAAACTGGCTCAGG - Intergenic
1180973381 22:19828903-19828925 CTCACTGCAACATCTGCCTCTGG + Intronic
1181646389 22:24233522-24233544 CACACTGGTCCAGCAGGCTCGGG + Exonic
1182503663 22:30766661-30766683 CTCACTGGATGAAATGGCCCAGG - Intronic
1183139170 22:35919857-35919879 CTCACTGCACTATCTAGCTCAGG + Intronic
1184583006 22:45429730-45429752 CTGCCTGGACCATCTGGCACAGG + Intronic
1185401832 22:50622939-50622961 ATCACTGGATTGACTGGCTCAGG + Intronic
950007092 3:9698412-9698434 CTGACTGGAGCAGCTGCCTCTGG + Intronic
950319460 3:12036553-12036575 CTCAGTGGACTTACTGCCTCGGG - Intronic
953019394 3:39104147-39104169 CTCACTGGGCTCCCTGGCTCAGG - Intronic
953136629 3:40187638-40187660 TCCACTGCACAAACTGGCTCTGG + Intronic
953250868 3:41244871-41244893 CCCACTGAACAAAATGGCTCTGG + Intronic
953675246 3:44996055-44996077 CTCACTGGAACTGCTGGCTTTGG + Intronic
954936317 3:54330300-54330322 CTCACTGCACCCAGTGACTCTGG + Intronic
958970277 3:100603483-100603505 CTATCTGGAACACCTGGCTCTGG + Intergenic
960134573 3:114092171-114092193 CTCACAGGACCAGCTGGTACAGG + Intergenic
962792050 3:138820565-138820587 CTCACTGCAACCACTGCCTCCGG + Intronic
962856391 3:139349665-139349687 CTGTCTGGTCCAACTGTCTCTGG - Intronic
967699874 3:192579625-192579647 CTCACTGCAACCACTGCCTCCGG + Intronic
969675746 4:8613480-8613502 CTCTCTGGTCCAGCTAGCTCTGG - Intronic
971217470 4:24674388-24674410 GGGGCTGGACCAACTGGCTCAGG + Intergenic
971242801 4:24903740-24903762 CTCACTGTACCTTCAGGCTCTGG + Intronic
971331908 4:25688575-25688597 CTCACTGCAACCTCTGGCTCTGG - Intergenic
972588473 4:40460812-40460834 CTCACTGCAACACCTGCCTCTGG - Intronic
973004074 4:44987995-44988017 CCCACTGGACCATCTGACTCAGG + Intergenic
974073496 4:57147179-57147201 ATCATTGGACCCACTGGCTTTGG - Intergenic
977255934 4:94740142-94740164 CTCACTGAAACATCTGCCTCTGG + Intergenic
979088838 4:116452343-116452365 CTCACTGCAACATCTGCCTCTGG + Intergenic
980778905 4:137471417-137471439 CTCACTGTAACCACTGCCTCCGG + Intergenic
986873528 5:12079275-12079297 CTCACTGCAACCACTGCCTCCGG - Intergenic
989331292 5:40261874-40261896 CTCACTGCAACATCTGCCTCCGG - Intergenic
990876694 5:60494353-60494375 CTCAGTGGCACAAGTGGCTCTGG - Intronic
996227595 5:121019774-121019796 CTCACAGGTCCACCTGGCTGGGG + Intergenic
996767223 5:127046628-127046650 ATCCCTGGGCCAACTGGCTATGG - Exonic
997481153 5:134185580-134185602 CTCACTGCAACCTCTGGCTCCGG + Intronic
997588957 5:135061393-135061415 CTCACTGCAACCACTGCCTCTGG + Intronic
1001708457 5:173759189-173759211 CTCAGTGGACCAGCTGTTTCTGG + Intergenic
1002163588 5:177331629-177331651 CTCACTTGAGCATCTGTCTCAGG + Exonic
1003950480 6:11111264-11111286 CCCATTGGACCAACTGCCTTGGG - Intronic
1004030319 6:11861968-11861990 CTCACTGCAACATCTGCCTCCGG - Intergenic
1004169967 6:13288244-13288266 CTCTCTGGATCAACTGGAGCAGG - Exonic
1008072975 6:47116558-47116580 CTCACTGGTCAAAGAGGCTCAGG - Intergenic
1011885266 6:92086132-92086154 CTCACAGTACCATCTGGCTTGGG - Intergenic
1013458254 6:110351734-110351756 CACACTGGACCAGCCGGCTCAGG - Intronic
1014245950 6:119068644-119068666 CTCACTGGGCCGTTTGGCTCTGG + Intronic
1015690223 6:135914020-135914042 CTCACTGGCCTCACTGGCACAGG + Intronic
1020211121 7:6158863-6158885 CCCGCTGGACCAGCTGCCTCGGG - Intronic
1020271673 7:6600289-6600311 CTCGCTGGACCGGCTGGCGCAGG + Exonic
1023299265 7:38751783-38751805 CTGACTGGAGCAACTGCTTCTGG + Intronic
1023631309 7:42166897-42166919 CTCACTGCACCCTCTGCCTCCGG + Intronic
1023731119 7:43193453-43193475 CTCACTGCACCCTCTGTCTCCGG + Intronic
1026112451 7:67469201-67469223 CTCACTGTAACCTCTGGCTCCGG + Intergenic
1026952827 7:74359036-74359058 CTCACTGCACCCTCTGCCTCTGG + Intronic
1029888817 7:103905052-103905074 CTCACTGCAACATCTGCCTCCGG + Intronic
1030424187 7:109351677-109351699 CTCACTGCACCCTCTGCCTCCGG - Intergenic
1031271257 7:119652526-119652548 CTCACTGTTCCAAGTGGCTGGGG + Intergenic
1032021310 7:128408508-128408530 CTCACTACACCACCTGGCTGGGG + Intronic
1034910688 7:154995773-154995795 CTCACTGCACCCTCTGCCTCAGG - Intronic
1038751436 8:30299843-30299865 CTCACTGCACCCTCTGCCTCTGG + Intergenic
1039916708 8:41865527-41865549 TTCACGGGTCCCACTGGCTCAGG + Intronic
1041402154 8:57457370-57457392 CTCACTTGACCACGTTGCTCAGG - Intergenic
1044701223 8:94966979-94967001 CTCACTGCACCAACTAAATCAGG + Intronic
1047105486 8:121726579-121726601 GTCACTGAACCCACTGGCCCTGG - Intergenic
1048111487 8:131473042-131473064 CTCACTGTTCCACATGGCTCGGG - Intergenic
1050605330 9:7295516-7295538 CTCACTGCAACCACTGCCTCAGG + Intergenic
1056132891 9:83602945-83602967 TTCCCTGGACCAATTGGCTACGG + Intergenic
1056168703 9:83962366-83962388 CTTTCTGGACAAACTGCCTCAGG + Intergenic
1057822712 9:98344766-98344788 CTCACTGCACCCACTTTCTCTGG + Intronic
1059105460 9:111507376-111507398 CTCACTGCAACCACTGCCTCTGG - Intergenic
1059255942 9:112930714-112930736 CTCTCTTGAACAACTTGCTCTGG - Intergenic
1059284017 9:113157457-113157479 CTCACTGGACCAACTGGCTCGGG - Intronic
1061704512 9:132442477-132442499 CTCACTGCACCCTCTGCCTCCGG - Intronic
1062182467 9:135197953-135197975 CTCACAGCAGCAACTGACTCAGG + Intergenic
1062699427 9:137891272-137891294 CTCTCTGGAGCAGCTGCCTCTGG + Intronic
1190356758 X:49613052-49613074 CTCACTGCAACCACTGCCTCCGG + Intergenic
1190758691 X:53422491-53422513 ATCATTGGACCCAATGGCTCTGG - Exonic
1191851481 X:65589046-65589068 CTGACTGGAGAAACTGGCTTGGG - Intronic
1194045152 X:88992957-88992979 GTAACTGGCCCAACTGGCTGGGG + Intergenic
1196022296 X:111002971-111002993 TTCCCTGGACCAACTGGGGCTGG + Intronic
1196405034 X:115352224-115352246 CTCACTGCAACCTCTGGCTCTGG - Intergenic
1198608905 X:138375301-138375323 CTCACTGTTCCACATGGCTCAGG + Intergenic
1199755165 X:150857246-150857268 ATCACTGGACCTCCTGGATCTGG - Intronic