ID: 1059284018

View in Genome Browser
Species Human (GRCh38)
Location 9:113157458-113157480
Sequence CCTCACTGGACCAACTGGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059284018_1059284024 9 Left 1059284018 9:113157458-113157480 CCGAGCCAGTTGGTCCAGTGAGG 0: 1
1: 0
2: 1
3: 7
4: 164
Right 1059284024 9:113157490-113157512 CCCACACCTCTATTCTCATATGG No data
1059284018_1059284027 16 Left 1059284018 9:113157458-113157480 CCGAGCCAGTTGGTCCAGTGAGG 0: 1
1: 0
2: 1
3: 7
4: 164
Right 1059284027 9:113157497-113157519 CTCTATTCTCATATGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059284018 Original CRISPR CCTCACTGGACCAACTGGCT CGG (reversed) Intronic
900780794 1:4615947-4615969 CCTCACTATACCCACTGGATAGG - Intergenic
903139403 1:21330075-21330097 CCTCCCTGGACCAAGTTACTGGG + Intronic
904656784 1:32054826-32054848 CCACACTGGAATAACTGCCTTGG - Intronic
908238043 1:62166293-62166315 CCTCAGTTCTCCAACTGGCTGGG + Intergenic
910361303 1:86415707-86415729 CCTCAATGGCCCAAGTAGCTGGG + Intergenic
913498427 1:119449128-119449150 CCTCACTGGACCACTAGACTGGG - Intergenic
915431835 1:155872633-155872655 CCTCACTAGGCCAAGGGGCTGGG + Intronic
916436720 1:164784376-164784398 CCTCCCTGGGCCAGCTGGCAGGG - Intronic
920534354 1:206728072-206728094 TCTCCCTGGACCAATTGGCTAGG - Intronic
924066237 1:240225216-240225238 CCTCACAGGAGCAACTGGAGAGG + Intronic
924250484 1:242128187-242128209 CCTCAGCTGACCAAGTGGCTGGG - Intronic
1068248809 10:54409166-54409188 GCTCACAGGTCCACCTGGCTGGG - Intronic
1070288749 10:75101234-75101256 CCCCACTGAAGAAACTGGCTTGG - Intronic
1070555821 10:77527219-77527241 TCCCACAGGACGAACTGGCTTGG + Intronic
1073210310 10:101795746-101795768 CCACACTGGAAGAACTGTCTTGG + Intronic
1074936548 10:118187562-118187584 CCTGACTGGGCAAACTAGCTTGG + Intergenic
1076841922 10:133050033-133050055 CCTCCCTGGCCCTGCTGGCTTGG - Intergenic
1077084786 11:744007-744029 CCACACTGGAAGAACTGTCTTGG - Intergenic
1078280378 11:9894864-9894886 CCTCAGTTGCCCAAGTGGCTGGG - Intronic
1078770906 11:14350633-14350655 CCACACTGGAAGAACTGTCTTGG + Intronic
1079533263 11:21480727-21480749 CCTCTCTGGCACAACTGGTTAGG - Intronic
1095173074 12:39057621-39057643 CCTCACTGAACTGACTGGCTGGG + Intergenic
1097934275 12:65227790-65227812 CCCCACTGGAAGAACTGTCTTGG - Intronic
1103774883 12:123360005-123360027 CCTCAGGTGACCAACCGGCTTGG - Intronic
1104171954 12:126290982-126291004 CCTCACAGTTCCACCTGGCTGGG + Intergenic
1106556923 13:30817835-30817857 CCTCCGTGGACCAATTGGCATGG - Intergenic
1107516296 13:41132741-41132763 CTTCACAGGACCCGCTGGCTTGG + Exonic
1113274810 13:108717018-108717040 CCTCATGAGACCAACTGCCTGGG - Intronic
1113672841 13:112186602-112186624 CCTCACATGACCAAAGGGCTGGG - Intergenic
1116212824 14:41969727-41969749 CCTCACTCCACCAAATTGCTGGG - Intergenic
1119343915 14:73905660-73905682 TCACGCTGGACCAAGTGGCTTGG - Intronic
1119564170 14:75614743-75614765 ACTCACTGCTCCAAATGGCTAGG + Intronic
1121328852 14:93037047-93037069 CCTCCCTGGTCCAGCTGCCTGGG - Intronic
1124339217 15:28879323-28879345 CCTCACTGGAAGCACTGGCAAGG - Intergenic
1127810585 15:62561777-62561799 CCTCAGTGGCTCAACTGGCTGGG - Intronic
1128356469 15:66930981-66931003 CCACACTTGCCCAGCTGGCTGGG - Intergenic
1131426599 15:92350357-92350379 CCTCCCTGGATGAGCTGGCTTGG + Intergenic
1132092922 15:98960349-98960371 CCTCACAGGGCCACCTGGCTAGG - Exonic
1132617395 16:848444-848466 CCCCACTGGACCTTCTGGCAGGG + Intergenic
1136033117 16:27517870-27517892 CCACACTAGGCCACCTGGCTAGG + Intronic
1137773201 16:51034717-51034739 CCTCACTGGGCCACCTGGGATGG - Intergenic
1138271681 16:55700199-55700221 CCGCCCTGGGCCAACTGGGTGGG + Exonic
1139967528 16:70754073-70754095 CCTCACTGGTCCATCTGCCCAGG + Intronic
1141509423 16:84503127-84503149 CCACACTGGAAGAACTGTCTTGG + Intronic
1142645640 17:1312433-1312455 CCTCACTGGGTCAGCTGACTGGG + Intergenic
1144514898 17:15910687-15910709 CCACACTGGAAGAACTGTCTTGG - Intergenic
1144807435 17:17977312-17977334 CCTCGCTGGACCCACTGGACTGG - Intronic
1146692124 17:34883765-34883787 CCTCCCCTGACCAAGTGGCTGGG + Intergenic
1147423199 17:40332563-40332585 CCTCACTGCCCGCACTGGCTGGG + Intronic
1148546329 17:48522122-48522144 CCTTACTGGACCAGCAGCCTAGG - Intergenic
1150563500 17:66316589-66316611 CCACACTGGAAGAACTGTCTTGG - Intronic
1151400128 17:73850514-73850536 CCTCAGAGGACCAGCTGCCTGGG + Intergenic
1151545644 17:74791303-74791325 CCTCACTGGAGTAGCTGCCTGGG - Intronic
1151545660 17:74791367-74791389 CCTCACTGGAGTAGCTGCCTGGG - Intronic
1151545667 17:74791399-74791421 CCTCACTGGAGTAGCTGCCTGGG - Intronic
1152884301 17:82840458-82840480 CCTCACTGGACCTCATGGCAAGG - Exonic
1156151448 18:34248934-34248956 ACTCACAGTTCCAACTGGCTGGG + Intergenic
1159777999 18:72626026-72626048 TCTCACTGGACCACAAGGCTGGG - Intronic
1161420466 19:4173711-4173733 CCTCCCTGGACCAGCTGCTTGGG - Intergenic
1165144914 19:33724759-33724781 CCTCTCTGTGCCACCTGGCTGGG - Intronic
1165226040 19:34355917-34355939 CGTCATTGGACAAGCTGGCTGGG - Intergenic
1165320285 19:35080708-35080730 CCACGGTGGAGCAACTGGCTGGG - Intergenic
1167905953 19:52660978-52661000 CCTCAGTGTACCAAGTAGCTGGG + Intronic
929915509 2:46132344-46132366 CCTCACTGGACATGCTGACTAGG - Intronic
930454242 2:51584628-51584650 CCTCACTGGATCAAATGCATAGG - Intergenic
931697172 2:64880021-64880043 CCTCACGGGACCAAACTGCTTGG - Intergenic
932726231 2:74182075-74182097 CCCAACAGCACCAACTGGCTGGG - Intergenic
933208345 2:79536189-79536211 CCTCACTTTCCCAAGTGGCTAGG + Intronic
933698733 2:85239196-85239218 CCTCACTGGACCAGCCCGCCAGG + Intronic
935383196 2:102474586-102474608 CCTCACTGGCCCCACTTGGTAGG - Intronic
940271016 2:151890094-151890116 CCTCACTCCACCAACGTGCTGGG - Intronic
943326923 2:186510923-186510945 CCACACTGGAAGAACTGTCTTGG - Intergenic
949042355 2:241855185-241855207 CCTGCCTCCACCAACTGGCTGGG + Intronic
1171774733 20:29354880-29354902 CCTCACAAGACCCATTGGCTTGG + Intergenic
1171816738 20:29792508-29792530 CCTCACAAGACCCATTGGCTTGG + Intergenic
1171901606 20:30863469-30863491 CCTCACAAGACCCATTGGCTTGG - Intergenic
1172296637 20:33816091-33816113 CCTCACTGGAACCACTACCTGGG - Intronic
1172435664 20:34927315-34927337 CCTCCCTTGACCAGCTGTCTGGG + Exonic
1172807514 20:37623003-37623025 CCTCCCAGGACCAGCAGGCTAGG - Intergenic
1172983110 20:38959934-38959956 CCTCACCTTCCCAACTGGCTGGG + Intergenic
1173534715 20:43800697-43800719 CCTCAGGGGCCCAAGTGGCTGGG + Intergenic
1173869455 20:46332392-46332414 CCTCACTGGCCCAACTGTGATGG + Intergenic
1176099499 20:63358534-63358556 CCTCCCTGGACCAGCGAGCTGGG + Intronic
1176204126 20:63878945-63878967 CCTCAGTGGACCAGAAGGCTGGG - Intronic
1179187563 21:39096651-39096673 CCTCTCTGGACCCCCTGGCATGG - Intergenic
1179395113 21:41032407-41032429 CTTCCCTGGACCTACTGACTTGG + Intergenic
1179797832 21:43795662-43795684 CCTCAGCCGCCCAACTGGCTGGG + Intronic
1180334976 22:11569417-11569439 CCTCACAAGACCCATTGGCTTGG - Intergenic
1184654989 22:45936605-45936627 CCTCAAAGGACCCCCTGGCTGGG + Intronic
949847346 3:8385093-8385115 CCACACTGGAAGAACTGCCTTGG + Intergenic
950003637 3:9677175-9677197 CCTCACTGAAGCCACTAGCTTGG + Intronic
950319461 3:12036554-12036576 CCTCAGTGGACTTACTGCCTCGG - Intronic
951898826 3:27636702-27636724 CGTCCCTGGACCAACAGGATTGG + Intergenic
952256656 3:31701550-31701572 CCCAACTGGAGTAACTGGCTGGG + Intronic
952300601 3:32101472-32101494 CCACACTGGAAGAACTGTCTTGG - Intergenic
952795955 3:37239277-37239299 CCACACTGGAAGAATTGGCTTGG + Intergenic
953524049 3:43672413-43672435 CCTCAGTGTCCCAACTAGCTGGG - Intronic
953657204 3:44863155-44863177 CCACACTGGAAGAACTGTCTTGG - Intronic
954498484 3:50988061-50988083 CCTCACAAGACCCACTGGCTTGG + Intronic
955725821 3:61931510-61931532 CCTCACTGGATCTGCTGGCGAGG + Intronic
958163828 3:89853435-89853457 CTTCACTGGACCACCTGGTATGG - Intergenic
960142037 3:114160103-114160125 AATCACTGGACTAACTGACTTGG - Intronic
960973498 3:123155562-123155584 CCCCACTGCACCAGCTGCCTGGG - Intronic
961562010 3:127737114-127737136 CCTCACTGGAACATCTGCCCAGG - Intronic
964761546 3:160138926-160138948 CCTCACTGTCCCAAGTAGCTGGG - Intergenic
964870582 3:161310178-161310200 CCTCACTGAACCAACTACTTGGG + Intergenic
967017331 3:185494090-185494112 CCTCAATGGACCACCTGGCTAGG - Intronic
968882184 4:3306839-3306861 CCTCACTGGAGGAGCTGGGTTGG + Intronic
969224843 4:5788946-5788968 CCACACTGGAAGAACTGACTTGG - Intronic
969746806 4:9079082-9079104 CCAACCTGGACCATCTGGCTGGG + Intergenic
969939368 4:10715226-10715248 CCTCTCTAGACCTACTGACTTGG + Intergenic
970426091 4:15947579-15947601 CCTTACTGGACCAAGTGACCAGG - Intergenic
971306878 4:25490628-25490650 CCTCAGTGGCCCAAATAGCTGGG - Intergenic
971416556 4:26437233-26437255 CCACACTGGAAGAACTGTCTTGG - Intergenic
971475259 4:27066503-27066525 CATCACTGGACCATTTGCCTTGG - Intergenic
973284853 4:48403662-48403684 CCTCACAAGACCTACTGGCTTGG - Intronic
983305281 4:165976973-165976995 CCACACTGGAAGAACTGTCTTGG - Intronic
985849638 5:2379169-2379191 CCTCACTGGGCCAGCTGCCCTGG + Intergenic
987051389 5:14149260-14149282 CCTCACTGGACAATCTAGCCAGG - Intronic
988547348 5:32171213-32171235 CCACACTGGAAGAACTGTCTTGG + Intronic
992086360 5:73281456-73281478 CCTCCCTGGAACAACTGCCCTGG + Intergenic
996227594 5:121019773-121019795 ACTCACAGGTCCACCTGGCTGGG + Intergenic
997633931 5:135390603-135390625 GCTCACTGAACCAACTGGGCAGG + Intronic
1000381282 5:160631822-160631844 CCTCATGGCAACAACTGGCTTGG - Intronic
1002182623 5:177438783-177438805 CCTCACTGGAACCGCTGGCCAGG + Intronic
1002978722 6:2112739-2112761 CCTCGCTGGCCTAACTGGCAAGG + Intronic
1003950482 6:11111265-11111287 ACCCATTGGACCAACTGCCTTGG - Intronic
1004336082 6:14765528-14765550 CCTCACTGTCCCAAGTAGCTGGG - Intergenic
1007416685 6:41695081-41695103 GCTCACTGCCCCTACTGGCTAGG + Intronic
1011469122 6:87689976-87689998 CCTCAAGTGACCAACTGCCTTGG - Intronic
1011885267 6:92086133-92086155 ACTCACAGTACCATCTGGCTTGG - Intergenic
1013607386 6:111762734-111762756 CCACACTGGAAGAACTGCCTTGG + Intronic
1014937761 6:127404094-127404116 CCACACTGGAAGAACTGTCTTGG - Intergenic
1016919190 6:149274233-149274255 CCTCACAGGAGCAACTGACCCGG + Intronic
1018996269 6:168712650-168712672 CCTCACTGGAGCAGGTGCCTGGG + Intergenic
1019696096 7:2446912-2446934 TCTTACTGGACCCAGTGGCTGGG - Intergenic
1021279429 7:18699111-18699133 CCTAACTGTGTCAACTGGCTGGG + Intronic
1022102144 7:27174991-27175013 CCTAACTGGATCAACGGACTAGG - Intronic
1023290233 7:38660483-38660505 CCTCACTGTCCCAAGTAGCTGGG + Intergenic
1025722012 7:64025632-64025654 TCTCTCTGGGCCCACTGGCTAGG + Intergenic
1028340010 7:89706624-89706646 GTTCACTGGACCCACTGACTGGG - Intergenic
1030014859 7:105208869-105208891 CCTCAGTGTCCCAAATGGCTGGG - Intronic
1030031380 7:105372971-105372993 CCTCAGTGGCCCAAGTAGCTGGG - Intronic
1030183668 7:106737680-106737702 TCTCACTGGACCAACAGGGGTGG - Intergenic
1031271256 7:119652525-119652547 ACTCACTGTTCCAAGTGGCTGGG + Intergenic
1031949167 7:127873948-127873970 ACTCACTGGAGCATCAGGCTTGG + Intronic
1032021309 7:128408507-128408529 TCTCACTACACCACCTGGCTGGG + Intronic
1033012025 7:137633094-137633116 CCTCAGTGGCCCAAGTAGCTGGG - Intronic
1034182480 7:149148930-149148952 CCACACTGGAAGAACTGTCTTGG - Intronic
1034218369 7:149424974-149424996 CATCACTGGATAAATTGGCTTGG + Intergenic
1035127493 7:156619052-156619074 GCTCTCTGGACCGACTGGCCGGG + Intergenic
1037441745 8:18923126-18923148 CCACACTGGAAGAACTGTCTTGG + Intronic
1044535412 8:93351968-93351990 TCTCACTGAAGCAGCTGGCTTGG + Intergenic
1045034263 8:98165197-98165219 CCTTGCTGCAGCAACTGGCTGGG - Intergenic
1045962221 8:107981403-107981425 CCTCAGTGCACCAAGTAGCTGGG - Intronic
1047871392 8:129086358-129086380 TCTCACTCAAACAACTGGCTTGG + Intergenic
1052982027 9:34457222-34457244 CCTCACTATACGAGCTGGCTAGG + Intronic
1057024622 9:91725610-91725632 CCTCTGTAGAACAACTGGCTTGG - Intronic
1059284018 9:113157458-113157480 CCTCACTGGACCAACTGGCTCGG - Intronic
1061443617 9:130624701-130624723 CCACACTGGAAGAACTGTCTTGG - Intronic
1062108568 9:134769266-134769288 AGTCACTGGGCCAACTGACTCGG - Intronic
1185712773 X:2317365-2317387 CCTCACTGTCCCAAGTAGCTGGG + Intronic
1190958540 X:55221441-55221463 AATCACAGGTCCAACTGGCTGGG - Exonic
1191665105 X:63694065-63694087 CCTCACTGTCCCAAGTAGCTGGG - Intronic
1191851482 X:65589047-65589069 CCTGACTGGAGAAACTGGCTTGG - Intronic
1192246093 X:69372854-69372876 CCTCAAGGGGCCATCTGGCTTGG + Intergenic
1192372686 X:70528036-70528058 CCTCACTGGAACATGGGGCTTGG + Intergenic
1194045151 X:88992956-88992978 GGTAACTGGCCCAACTGGCTGGG + Intergenic
1195681668 X:107551650-107551672 CCTCTCTGGGACAAGTGGCTTGG - Intronic
1201791684 Y:17848228-17848250 CCTCATTGGACCCAGTGTCTTGG - Intergenic
1201809870 Y:18057761-18057783 CCTCATTGGACCCAGTGTCTTGG + Intergenic
1202353290 Y:24017883-24017905 CCTCATTGGACCCAGTGTCTTGG - Intergenic
1202517489 Y:25652232-25652254 CCTCATTGGACCCAGTGTCTTGG + Intergenic