ID: 1059284021

View in Genome Browser
Species Human (GRCh38)
Location 9:113157463-113157485
Sequence TCCATCCTCACTGGACCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059284021_1059284027 11 Left 1059284021 9:113157463-113157485 CCAGTTGGTCCAGTGAGGATGGA 0: 1
1: 0
2: 0
3: 11
4: 99
Right 1059284027 9:113157497-113157519 CTCTATTCTCATATGGAGCATGG No data
1059284021_1059284024 4 Left 1059284021 9:113157463-113157485 CCAGTTGGTCCAGTGAGGATGGA 0: 1
1: 0
2: 0
3: 11
4: 99
Right 1059284024 9:113157490-113157512 CCCACACCTCTATTCTCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059284021 Original CRISPR TCCATCCTCACTGGACCAAC TGG (reversed) Intronic
902664700 1:17929364-17929386 GCCACCCTCAATGGACTAACAGG + Intergenic
903737624 1:25540270-25540292 TTCTTCCTCAGTGGACCCACAGG - Intergenic
903788172 1:25875144-25875166 CCCCTGCTCACTGGACAAACAGG + Intergenic
912800786 1:112718791-112718813 TCCATCCTCACTGAACCTGCGGG + Intergenic
913177992 1:116292444-116292466 TCCTTCCTCACTCCACCAACTGG - Intergenic
915911535 1:159918575-159918597 GCCATCAAAACTGGACCAACTGG - Exonic
916078846 1:161219412-161219434 TCCATCCTCAGAGCACCTACAGG - Intronic
916417031 1:164601724-164601746 TTCATCTTCCCTGGAACAACAGG - Intronic
916748828 1:167705549-167705571 TTCATCCTCACAGGATCAATCGG - Exonic
920111941 1:203592940-203592962 TCCATTCTCACATGATCAACTGG + Intergenic
922982052 1:229835469-229835491 TCCATATTCACTGGAACAACGGG - Intergenic
924513758 1:244749647-244749669 TCCATCCTCATGGCACCAAGAGG + Intergenic
1065021122 10:21502210-21502232 TCCATCCTCACTCAACCACCAGG + Intergenic
1066210240 10:33229972-33229994 TCCATCCTTACTAAACCCACTGG - Intronic
1068579127 10:58719348-58719370 TCCATCCTCCCTTTTCCAACTGG + Intronic
1071543502 10:86509396-86509418 TCCTTTCTCAGTGCACCAACAGG + Intronic
1077190011 11:1252027-1252049 TCCATCCCCACTGGCCACACTGG + Intronic
1077193868 11:1269535-1269557 TCCATCCCCACAAGACCACCTGG + Intergenic
1077300898 11:1846480-1846502 GCCTGCCTCACTGGACCACCAGG + Intergenic
1080071696 11:28096666-28096688 TCCATCCTTACTTGATCAAGAGG + Intronic
1080611383 11:33906942-33906964 TCCACTCTCACTGGACAATCAGG + Intergenic
1083913452 11:65724488-65724510 CTTATCCTCACTGTACCAACAGG - Intergenic
1085279247 11:75319561-75319583 TCCGTCCTCACTGCTCCATCAGG + Intronic
1086059346 11:82684195-82684217 TCCATTCTATCTGGACCAACAGG + Intergenic
1092968877 12:13672424-13672446 TAAATCCTCCCTGGACCAAGGGG + Intronic
1098143185 12:67471710-67471732 TCCCTTCTCACTGGGCCCACAGG - Intergenic
1100572758 12:95858587-95858609 TCCTTCCTCACTCTTCCAACAGG - Intergenic
1104949817 12:132434358-132434380 TCCGTCCTCATTGGTACAACAGG + Intergenic
1106477483 13:30110947-30110969 TCCATCCTCTCTCCACCCACAGG + Intergenic
1111076513 13:83243014-83243036 TCAATCCACACTGGTCCAGCAGG - Intergenic
1114527117 14:23373336-23373358 TCCATCTTCACTGGCCCTACAGG - Exonic
1119110036 14:71963508-71963530 TCCATCCTCCCTGCAGCTACTGG + Intronic
1119379637 14:74220226-74220248 TCCATCCTCCGTGGACCGTCTGG - Intergenic
1123673656 15:22686690-22686712 CCCATCGTCTCTGGAACAACTGG - Intergenic
1124325658 15:28759681-28759703 CCCATCGTCTCTGGAACAACTGG - Intergenic
1127455707 15:59154350-59154372 TCCATCCGGACTGATCCAACTGG - Intronic
1129243778 15:74267740-74267762 TCCATCCTCACTGGCAAAGCTGG + Intronic
1132383710 15:101384839-101384861 TCCATCCTGTGTGGACCCACTGG + Intronic
1136025263 16:27464579-27464601 CCCATTCTCACTGGCCCAGCTGG + Exonic
1136587957 16:31199974-31199996 TCCAACCTCACTGCCCCACCAGG - Intergenic
1141242222 16:82274644-82274666 TCCATCCCCCCTGGAACCACAGG - Intergenic
1142624625 17:1183888-1183910 TGCACCCTCACTGGCCCATCAGG + Intronic
1144858095 17:18281807-18281829 TCCATCCTGCCTGGCCCACCTGG - Intronic
1149553074 17:57554406-57554428 CCCAGCCTCACTGGAGCAACTGG - Intronic
1155333971 18:24746294-24746316 ACCATCCTCACAGGAGCAAAAGG + Intergenic
1157259561 18:46166533-46166555 GCCATCCTCCCAGCACCAACTGG + Intergenic
1157491184 18:48124894-48124916 TCCATCCTGGCTGTCCCAACTGG - Intronic
1159122139 18:64183461-64183483 TCCTTCCTCACGAAACCAACAGG - Intergenic
1159389934 18:67778206-67778228 TCCATCATCACTCAACCAACAGG + Intergenic
1159892920 18:73969377-73969399 TCCTGCCTCACTGGCCCAACAGG + Intergenic
1161363832 19:3867639-3867661 TCCCTCCTCACTGTCCCAGCAGG + Intronic
1164458136 19:28426233-28426255 TCCCTGGTCACTGGACCTACAGG - Intergenic
927822435 2:26280028-26280050 TCCTTCCTCACTGGAGCAGATGG + Exonic
929793548 2:45041123-45041145 TGCATCCTCACTGCACATACTGG - Intergenic
933680466 2:85095376-85095398 TCCCACCTCACTGGAACTACAGG + Intergenic
941511633 2:166417839-166417861 TCAATCCTCACTGAACCATTTGG + Intronic
941928603 2:170919371-170919393 TTCATCTTCACAGGACCCACAGG + Intergenic
942519815 2:176791671-176791693 TTCACCCTCTTTGGACCAACAGG + Intergenic
1169183784 20:3594579-3594601 ACCATACTCCCTGGACCACCAGG + Intronic
1169888790 20:10431817-10431839 GCCATCCTCTGTGGACCAAAGGG - Intronic
1182414209 22:30210561-30210583 TCCTTACTCACCGGGCCAACTGG + Intergenic
1183380649 22:37489043-37489065 TCCATGCTCACTCCACCATCCGG + Intergenic
1184129445 22:42509099-42509121 TCCAGACTCACTTGATCAACAGG - Intergenic
1185192605 22:49448070-49448092 TCCATCCTCCCTGGCTCAGCAGG + Intronic
1185358373 22:50389153-50389175 CCCATCCTCAGTGGTCCATCTGG - Intronic
950236825 3:11329342-11329364 TCCATCCTTACAGAACTAACTGG + Intronic
950460896 3:13121760-13121782 TCCATGGTCGCTGGAGCAACAGG + Intergenic
953228352 3:41041737-41041759 TCCAGTCTAATTGGACCAACTGG + Intergenic
954997654 3:54896217-54896239 TGCCTCCTCGCTGGACAAACAGG - Intronic
959562434 3:107798138-107798160 ACCATCCTCTCTAGGCCAACTGG + Intronic
969146790 4:5130958-5130980 TCCATCCTCTTGGGACCATCAGG - Intronic
969968939 4:11026374-11026396 CCCATCCTCACAGGACTCACAGG + Intergenic
980984550 4:139683016-139683038 TGCATGCTCACTGGAGGAACAGG - Intronic
981719800 4:147789839-147789861 TCCTGTCTCCCTGGACCAACAGG - Intronic
984735285 4:183102431-183102453 ACCTACCTCACAGGACCAACGGG - Intronic
985658693 5:1144993-1145015 GCCAGCACCACTGGACCAACCGG + Intergenic
989127995 5:38075507-38075529 ACCATCCTCAGTGGCCCCACTGG - Intergenic
989544678 5:42659553-42659575 TCCATCCTCACACGGCCAAAAGG + Intronic
998481336 5:142465742-142465764 TCCTTCCTCCCTGGACCTCCAGG + Intergenic
1002423815 5:179164343-179164365 TCCTTCCTCACTGACCCAAAGGG - Intronic
1002805106 6:566446-566468 TCCTTCCTCACTGCAGCACCAGG - Intronic
1002977109 6:2091346-2091368 TCCATCCTCTTTGGACTATCAGG + Intronic
1003312076 6:4978084-4978106 GGCTTCCTCACTGGAACAACAGG - Intergenic
1005398921 6:25411813-25411835 TCTCTGCTCCCTGGACCAACAGG - Intronic
1007597704 6:43061614-43061636 TCCATCCACCCTGGACCACTTGG - Intronic
1009482458 6:64176142-64176164 CCCATCCCCACTGGACCATATGG - Intronic
1009647234 6:66421578-66421600 TCCTTCCTCTCTGGAACAAAAGG + Intergenic
1017153275 6:151300390-151300412 TACATCCTCATTGGACGACCGGG - Intronic
1019187867 6:170231498-170231520 TCCATTCCCACTTGGCCAACAGG + Intergenic
1019502726 7:1372916-1372938 TCCTTCCTCACTGGCCAACCAGG - Intergenic
1021912362 7:25399131-25399153 TCAATACACACTGGACCAAATGG - Intergenic
1023291046 7:38669457-38669479 TCCATCCTCACTGGAAATTCTGG - Intergenic
1029847784 7:103430580-103430602 GCCATCCTCTCTGGAACAGCAGG - Intronic
1030183671 7:106737685-106737707 AACTTTCTCACTGGACCAACAGG - Intergenic
1037319894 8:17632219-17632241 TCCATCCTCACTGCAAAAAAGGG + Intronic
1037931071 8:22880747-22880769 CCCACCCTCACTGGTCCACCTGG - Intronic
1038798074 8:30727234-30727256 TCCATCCTCACTTGTCCAAGTGG - Intronic
1043113752 8:76221467-76221489 TACATCCTCCTTGGACTAACAGG + Intergenic
1045850908 8:106697199-106697221 CCCATCAAAACTGGACCAACTGG - Intronic
1050117207 9:2275277-2275299 TCCAGCCTCATTGTGCCAACAGG - Intergenic
1050682282 9:8125979-8126001 TCCATCCTGACTGGATCATTAGG - Intergenic
1050799499 9:9592446-9592468 TCCACCCACACTGGACAGACTGG - Intronic
1058946772 9:109864496-109864518 TCCATCCTTACTGCACAACCAGG + Intronic
1059284021 9:113157463-113157485 TCCATCCTCACTGGACCAACTGG - Intronic
1059442278 9:114315169-114315191 AGCATCCTCACTGGCCCACCTGG - Intergenic
1061394720 9:130337729-130337751 TCCATCCTCCCTGAACCACCAGG - Intronic
1061762503 9:132860188-132860210 CCCTCCCTCACTGGACCATCAGG - Intronic
1186025482 X:5306256-5306278 TCCTTCCTCACTGGAGCAGATGG - Intergenic
1186363832 X:8871182-8871204 TCCATCCTCTCTGTACCCTCAGG - Intergenic
1186788861 X:12977288-12977310 TCCCTCCCCAATGGACCAAGAGG - Intergenic
1198341009 X:135713499-135713521 TCCATCCCCTTTGGACCAAACGG + Exonic