ID: 1059284027

View in Genome Browser
Species Human (GRCh38)
Location 9:113157497-113157519
Sequence CTCTATTCTCATATGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059284021_1059284027 11 Left 1059284021 9:113157463-113157485 CCAGTTGGTCCAGTGAGGATGGA 0: 1
1: 0
2: 0
3: 11
4: 99
Right 1059284027 9:113157497-113157519 CTCTATTCTCATATGGAGCATGG No data
1059284022_1059284027 2 Left 1059284022 9:113157472-113157494 CCAGTGAGGATGGACACTCCCAC 0: 1
1: 0
2: 0
3: 6
4: 141
Right 1059284027 9:113157497-113157519 CTCTATTCTCATATGGAGCATGG No data
1059284018_1059284027 16 Left 1059284018 9:113157458-113157480 CCGAGCCAGTTGGTCCAGTGAGG 0: 1
1: 0
2: 1
3: 7
4: 164
Right 1059284027 9:113157497-113157519 CTCTATTCTCATATGGAGCATGG No data
1059284017_1059284027 17 Left 1059284017 9:113157457-113157479 CCCGAGCCAGTTGGTCCAGTGAG 0: 1
1: 0
2: 0
3: 7
4: 186
Right 1059284027 9:113157497-113157519 CTCTATTCTCATATGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059284027 Original CRISPR CTCTATTCTCATATGGAGCA TGG Intronic
No off target data available for this crispr