ID: 1059290621

View in Genome Browser
Species Human (GRCh38)
Location 9:113221078-113221100
Sequence AAGGGTCTCCCCCCGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 51}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059290613_1059290621 14 Left 1059290613 9:113221041-113221063 CCCAGATTCTGAGAGGTGTAGAG 0: 1
1: 0
2: 1
3: 23
4: 178
Right 1059290621 9:113221078-113221100 AAGGGTCTCCCCCCGGAAGTTGG 0: 1
1: 0
2: 0
3: 5
4: 51
1059290614_1059290621 13 Left 1059290614 9:113221042-113221064 CCAGATTCTGAGAGGTGTAGAGC 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1059290621 9:113221078-113221100 AAGGGTCTCCCCCCGGAAGTTGG 0: 1
1: 0
2: 0
3: 5
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059290621 Original CRISPR AAGGGTCTCCCCCCGGAAGT TGG Intronic
900522245 1:3111346-3111368 AAGAGTCTCCCTCCTGAAGGTGG + Intronic
902979743 1:20114123-20114145 AGGGGTCTGCCCCCGGCAGTGGG + Exonic
917806575 1:178619004-178619026 CAGGGTCTACCCCTGGAGGTGGG - Intergenic
918310789 1:183283862-183283884 CAGGGTCTCCTCTCGGAAGAGGG - Intronic
918447849 1:184632670-184632692 ATAGGTCTCCCTCCAGAAGTTGG + Intergenic
920287474 1:204890940-204890962 AATGGTCTCACCCTGGTAGTGGG + Intronic
922564872 1:226595230-226595252 AAGCGTCTCACCCTGGAAGGAGG + Intronic
1075554402 10:123419863-123419885 AGGGCTCTCCCCTGGGAAGTGGG + Intergenic
1077379486 11:2222563-2222585 AAGGGTCTTGCCCCAGCAGTGGG + Intergenic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1091181229 11:133606288-133606310 AAGGGTCTTCCCAAGGAGGTGGG + Intergenic
1113680087 13:112237709-112237731 AAGGGTTTCCCCCTGAAAATCGG - Intergenic
1128296619 15:66526080-66526102 AAAGACCTCCCCCCGGGAGTGGG + Intronic
1132496460 16:265655-265677 AAGGGTCTCCCCCAGCAGGATGG + Exonic
1132830613 16:1926301-1926323 GAGGTGCTGCCCCCGGAAGTAGG - Intergenic
1136292789 16:29285772-29285794 AGGGGTCTCTCCCTGGAAGGAGG - Intergenic
1142361869 16:89631169-89631191 ATGGGCCTCCCCCCGGGAGAAGG - Intronic
1142886060 17:2912629-2912651 AAGGGCCTCCCTCCAGCAGTAGG - Intronic
1145259550 17:21346666-21346688 AAGGGTTTCACCCCACAAGTTGG + Intergenic
1145317067 17:21741282-21741304 AAGGGTTTCACCCCACAAGTTGG - Intergenic
1146133405 17:30297432-30297454 AATGGTCTGCCACCTGAAGTTGG - Intergenic
1152190056 17:78882907-78882929 GAGGGTCTCCCCCGGGCACTGGG + Intronic
1157812627 18:50708600-50708622 TAGGGTCTCCACCAGGAAGACGG + Intronic
1159098865 18:63936853-63936875 AAGGAACTCCCCCCGGAGTTGGG + Intergenic
1160795374 19:942821-942843 ACGGGGCTCCTCCCGGAAGGCGG - Intronic
1161025685 19:2035688-2035710 AAGGGTCTCCTCCTGGGAGAGGG - Intergenic
1161395771 19:4044155-4044177 CAGGGTCTTCCCCTGGAAGTGGG - Intergenic
1164811026 19:31155863-31155885 AAGGTTCTCCTCCAGGAAGTTGG - Intergenic
1164866511 19:31608773-31608795 GAGGGTCTGCCCCTGGAACTTGG + Intergenic
1167422866 19:49414230-49414252 CAGGGTCTACTCCCGGAAGATGG + Intronic
927851623 2:26503429-26503451 AACGGTTTCCCCCCAGAAATAGG + Intronic
942884439 2:180906015-180906037 CAGGGTCATCCCCAGGAAGTTGG - Intergenic
945306759 2:208266339-208266361 ACGGCTCAGCCCCCGGAAGTCGG - Exonic
1169854916 20:10091978-10092000 AAGGGTTTCAACCCAGAAGTTGG - Intergenic
1176299960 21:5094874-5094896 TGGGGTCTCCTCCCGGAAGTGGG + Intergenic
1179857062 21:44167037-44167059 TGGGGTCTCCTCCCGGAAGTGGG - Intergenic
1184520014 22:44987859-44987881 AAAGGTCTCCCCCAGCAGGTGGG + Intronic
953805681 3:46065544-46065566 AAGGGCCTCCACCCAGGAGTCGG - Intergenic
955105769 3:55896200-55896222 AAGGGTTTCCACAGGGAAGTTGG + Intronic
955668075 3:61371312-61371334 AAGGGTCTCCCTCTGGTGGTGGG + Intergenic
956829629 3:73033018-73033040 ATGGGTCTCCCACCGTAAGATGG - Intronic
957491191 3:80929343-80929365 TAGGGTCTCCCCGCCCAAGTTGG + Intergenic
968502205 4:956041-956063 AAGGTTGTCCTCCCTGAAGTGGG - Intronic
976140893 4:81990473-81990495 AAGGGTCCTCCCCCGGCATTTGG + Intronic
981201471 4:141984173-141984195 ACTGGTCTCCTCCCCGAAGTTGG - Intergenic
981227586 4:142314713-142314735 AAGGATCCCCCGCCAGAAGTTGG - Exonic
982127481 4:152197054-152197076 AAGGGTTTCCCCCACGAACTTGG - Intergenic
983163493 4:164447058-164447080 AAGGGTCTCCACCAGCAAGAAGG - Intergenic
1022505759 7:30907948-30907970 AAGGCTCTCCCACCGGGAGACGG + Intergenic
1030672130 7:112349448-112349470 AAGGGTCTGCCCCATGCAGTTGG + Intergenic
1037964018 8:23119343-23119365 AAGTCACTCCCCCAGGAAGTAGG + Intergenic
1043497720 8:80821329-80821351 ATGTGTCTGCCCCAGGAAGTTGG - Intronic
1045683598 8:104688651-104688673 CTGGGTCTCCCCCTGGAGGTAGG - Intronic
1049312701 8:141941918-141941940 AAGCCTCTCCCCCTAGAAGTTGG + Intergenic
1056005507 9:82266214-82266236 AAGGGTTTTGCCCCAGAAGTGGG - Intergenic
1059290621 9:113221078-113221100 AAGGGTCTCCCCCCGGAAGTTGG + Intronic
1200918161 Y:8589675-8589697 GAGGGTCTCCTCCATGAAGTGGG - Intergenic