ID: 1059294904

View in Genome Browser
Species Human (GRCh38)
Location 9:113261666-113261688
Sequence CGTGCATCAGAATCACCTGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1701
Summary {0: 1, 1: 9, 2: 166, 3: 517, 4: 1008}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059294903_1059294904 6 Left 1059294903 9:113261637-113261659 CCTCTAAAACTGTGATTTTCAAG 0: 1
1: 0
2: 4
3: 34
4: 410
Right 1059294904 9:113261666-113261688 CGTGCATCAGAATCACCTGTAGG 0: 1
1: 9
2: 166
3: 517
4: 1008

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059294904 Original CRISPR CGTGCATCAGAATCACCTGT AGG Exonic