ID: 1059295164

View in Genome Browser
Species Human (GRCh38)
Location 9:113263936-113263958
Sequence CCTTATAAGGAGCAGGCGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059295153_1059295164 24 Left 1059295153 9:113263889-113263911 CCTTTCAGGCTGTGGGTACTGGT 0: 2
1: 0
2: 3
3: 12
4: 141
Right 1059295164 9:113263936-113263958 CCTTATAAGGAGCAGGCGGAGGG 0: 1
1: 1
2: 1
3: 19
4: 169
1059295151_1059295164 25 Left 1059295151 9:113263888-113263910 CCCTTTCAGGCTGTGGGTACTGG 0: 2
1: 0
2: 0
3: 9
4: 202
Right 1059295164 9:113263936-113263958 CCTTATAAGGAGCAGGCGGAGGG 0: 1
1: 1
2: 1
3: 19
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059295164 Original CRISPR CCTTATAAGGAGCAGGCGGA GGG Exonic
902574218 1:17367146-17367168 CCTTATAAGGGGGAGGCAGAGGG - Intergenic
902666180 1:17940259-17940281 CCTTATAAGAAGGAGGCAGGAGG - Intergenic
902753238 1:18532017-18532039 CCTTATAAGAGGGAGGCAGAGGG + Intergenic
903041176 1:20531890-20531912 CCTTATAAGAAGGAGGCAGAAGG + Intergenic
905475963 1:38228240-38228262 CCTTATAAGAGGGAGGCAGAGGG + Intergenic
905847697 1:41246499-41246521 CTTTATAAGGAGCAGCTGAAAGG + Intergenic
906896173 1:49774476-49774498 CTTTATATGGGGCAGGTGGAGGG + Intronic
907853440 1:58278707-58278729 CCTGATCAGCAGCAGGCGGGGGG + Intronic
918743909 1:188173770-188173792 CCTTATAAGAGGGAGGCAGATGG + Intergenic
918861488 1:189831993-189832015 CCTTATAAGATGAAGGCAGAGGG - Intergenic
919183684 1:194117787-194117809 CCCTAGAGGGAGCAGGCAGATGG + Intergenic
920334433 1:205235141-205235163 CCTTATATGAAGCAGGCAGAGGG + Intronic
921546206 1:216478009-216478031 CTTTATAAGAAGGAGGCAGAGGG + Intergenic
922466087 1:225846198-225846220 CCTTGGAGGGAGCAGACGGAGGG + Exonic
923773906 1:236961358-236961380 CCTTATAAGAGGGAGGCTGAGGG - Intergenic
1065620496 10:27576207-27576229 CCTTATAAGAGGTAGGCAGAGGG - Intergenic
1066657313 10:37708285-37708307 CCTTATAAGAAAGAGGCAGAGGG + Intergenic
1069062319 10:63906892-63906914 CCTTATAAGAGGAAGGCAGAAGG + Intergenic
1069567603 10:69474177-69474199 TCTGAAAAGGAGCAGGCGGTGGG - Intronic
1069869524 10:71524688-71524710 CCTTATAAGAAGCAGGTAGGAGG + Intronic
1070629443 10:78074475-78074497 CCTTATAAGAAGGAGGCAGGAGG + Intergenic
1071374166 10:84985711-84985733 CCTTATCAGGGGGAGGCAGAGGG + Intergenic
1074912827 10:117927247-117927269 CCTTATAAGACGGAGGCAGAGGG - Intergenic
1075182851 10:120227584-120227606 CCTTATAAGGGAGAGGCAGAGGG - Intergenic
1076058554 10:127395288-127395310 ACTTATGTGGAGCAGGCAGAGGG - Intronic
1080908035 11:36566505-36566527 GATTTTAAGGAGCAGGAGGATGG + Intronic
1080934021 11:36842776-36842798 CCTTATAAGAAAGAGGCAGAGGG - Intergenic
1082795780 11:57376848-57376870 GCTTAGAAGGAGCAGACGAAGGG + Exonic
1084317614 11:68354495-68354517 CCTTCTCAGGAGGTGGCGGAGGG + Intronic
1084404287 11:68962038-68962060 CCTTATAAGGGGAAGCAGGAGGG + Intergenic
1084724167 11:70929636-70929658 CCTTATAAGAGGAAGGCAGAGGG - Intronic
1087157790 11:94921848-94921870 CATTATAAGGAGAAGGCAGGAGG - Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090571745 11:128054717-128054739 CCACATAAGGTGCAGGTGGATGG + Intergenic
1090743384 11:129687335-129687357 CCTTATAAGGAGTAGCCCTAGGG + Intergenic
1093378596 12:18461996-18462018 CCTTATAAGAGGGAGGCAGATGG - Intronic
1093749161 12:22779027-22779049 CCTTACAAGGAGTAGGTGCAAGG - Intergenic
1095494733 12:42772499-42772521 CCTTACAAGAAGGAGGCAGAGGG - Intergenic
1096635986 12:52959947-52959969 CCTTATAAGAAGGAGGCAGAAGG - Intergenic
1098591450 12:72218765-72218787 CCTTATAAGAAGAAGGGAGAGGG - Intronic
1099360170 12:81690937-81690959 CCTTATAAGAAGGAGGCAAAAGG - Intronic
1100930137 12:99599076-99599098 CCTTATAAGAAGGAGACAGAGGG - Intronic
1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG + Intronic
1102731263 12:115112731-115112753 CCTTATAAAGAAAAGGCAGAAGG - Intergenic
1103326786 12:120126832-120126854 CCTTCTAAGAATCAGGAGGAAGG + Intergenic
1104289074 12:127451984-127452006 CATTATAAGAAGGAGGCAGAAGG - Intergenic
1104630300 12:130395088-130395110 CCTTAGAAGCAGCGGGAGGAAGG + Intergenic
1104701374 12:130907000-130907022 CCTTAGAAGGCCCAGGCAGAAGG - Intergenic
1105705289 13:22964512-22964534 CCTTCTCAGGAGAAGGCTGAAGG - Intergenic
1107950331 13:45455562-45455584 CCTTATAAGACACAGGCAGAGGG - Intergenic
1110802929 13:79721304-79721326 TCTTATAAGGGGAAGGCAGAAGG + Intergenic
1112378571 13:98866364-98866386 CCTTTTAAGGATCAGGCAGGGGG - Intronic
1114490896 14:23101332-23101354 GCTTACAAGGTGCAGGTGGAGGG - Intergenic
1116478787 14:45372429-45372451 CCTTATCAGGAGCAGCCTTATGG + Intergenic
1117011132 14:51471895-51471917 CCTTATAAAGGGCTGGAGGAGGG + Intergenic
1117626861 14:57649456-57649478 CTTTATAAGAAGCAGGCAGGAGG - Intronic
1120219822 14:81719547-81719569 CCTTATAAGAGGAAGGCGGGTGG - Intergenic
1121070240 14:91012830-91012852 CCTCAAAAGGAGCTGGAGGAAGG + Intronic
1121245723 14:92459701-92459723 CCCTGTGAGGAGCAGGCGGTGGG + Intronic
1121794872 14:96726413-96726435 CCTTCTAAGAAGGAGGCAGAGGG + Intergenic
1123043521 14:105500164-105500186 CCTTAGGAGGAGCTGGCGGAGGG - Intergenic
1126382496 15:48063687-48063709 CCTTATAAGAAAAAGGCAGAGGG + Intergenic
1127282361 15:57503227-57503249 CCTCATCAGGAGTAGGAGGAAGG - Intronic
1131510324 15:93046212-93046234 CTTTATAAGAAGGAGGCAGAGGG + Intronic
1135804401 16:25529030-25529052 CCTCATATGGTGCAGGGGGAAGG + Intergenic
1138433055 16:56981731-56981753 CCTTAAAGAAAGCAGGCGGAGGG + Intronic
1139015122 16:62680497-62680519 CTTTATATGGAGCAGGAAGAGGG + Intergenic
1143366362 17:6411172-6411194 CCTTATAAGACGGAGGCAGAAGG + Intronic
1150050261 17:61955168-61955190 TCTTATAAGAAGGAGGCAGAAGG - Intronic
1150884029 17:69064407-69064429 TCCTATAAGGAGCAGGAAGATGG - Intergenic
1151271844 17:73002918-73002940 CCTTATAAGAGGGAGGCAGAGGG - Intronic
1151422229 17:74006072-74006094 CCTTAAAAGGAAGAGGCAGAAGG + Intergenic
1153626495 18:7026398-7026420 CCTTAGAGGTAGCAGTCGGAAGG - Intronic
1153842413 18:9018670-9018692 CCTTCTAAGGGGGAGGCAGAAGG + Intergenic
1154088095 18:11327064-11327086 CCTTATAAGAAGGAGGCAAAAGG + Intergenic
1156093088 18:33494819-33494841 CCTTATAAGAAGCAGGCAGAGGG - Intergenic
1156536798 18:37872185-37872207 CCATGTAAGGAGCAGGAAGAGGG + Intergenic
1163627992 19:18401919-18401941 TTTTATAAGGAGCAGAGGGATGG + Intergenic
1167582756 19:50356126-50356148 CCTTATAAGAGGGAGGCAGAGGG - Intronic
926820996 2:16851735-16851757 CCTTATAAGAGGCAGGCAGAAGG - Intergenic
928954019 2:36842846-36842868 CCTGAGAAGTAACAGGCGGAGGG + Intergenic
930322462 2:49873853-49873875 CCTTATAAGAAAGAGGCAGAAGG + Intergenic
932206682 2:69889573-69889595 CCTTATAAGGGACAGGCAGAGGG - Intergenic
932484074 2:72070632-72070654 CCTTATAAGAGGCAGGCAGAGGG + Intergenic
933500841 2:83109316-83109338 CCTTATAAGAAGGAGACAGAGGG - Intergenic
935384635 2:102487467-102487489 CCCTTTAAGGAGCAGCCTGAGGG + Intronic
937080901 2:119139008-119139030 CCTTATAAGAAGGAGGCAGCGGG - Intergenic
939683314 2:145166501-145166523 CCTTAGAAAGAGGAGGTGGAGGG - Intergenic
940479710 2:154212715-154212737 CCTTAGAAGGAGAAGAAGGATGG - Intronic
940541817 2:155029946-155029968 CCTTATAAGTGGGAGGCAGAGGG + Intergenic
944215460 2:197250316-197250338 CCTTATAAGAAACAGGTGCAGGG - Intronic
945339800 2:208639505-208639527 CCTGATATGGACCAGGAGGAAGG + Intronic
947152783 2:227131773-227131795 CTTTATAAGGAGGACGCAGAGGG + Intronic
1168937442 20:1678208-1678230 CCTTATAAGAAGGAGGAGGCAGG - Intergenic
1170557382 20:17525694-17525716 CCTTATAGGGAACAAGGGGAGGG - Intronic
1175830410 20:61962264-61962286 CCTGATAAGGGGAAGGCGGATGG + Intronic
1175931112 20:62494170-62494192 CCTTATAAGAGACAGGCAGAGGG - Intergenic
1176033824 20:63026766-63026788 CCATTTAAGGAGCAGGTTGAAGG + Intergenic
1176052775 20:63129286-63129308 CCTCCTGAGGAGCAGGTGGACGG - Intergenic
1177023208 21:15888706-15888728 CCTAATAAGCAGCAGTCAGAGGG + Intergenic
1177420702 21:20853139-20853161 CCTTATAAGAGGGAGACGGAAGG - Intergenic
1178597949 21:33972017-33972039 TCTTATAAGAAGAAGGCAGAGGG - Intergenic
1178642357 21:34355349-34355371 CCTTATAAGAAGCAGGCAGGGGG + Intergenic
1178952666 21:36998058-36998080 CCTCATAAGAAAAAGGCGGAAGG - Intergenic
1179002669 21:37477683-37477705 TCTTATTAGGAGCAGTTGGAGGG + Intronic
1180743119 22:18067540-18067562 CCTCATAAGGATCAGGAGGAGGG - Intergenic
1181878366 22:25957800-25957822 CCTTATAAGAAAAAGGCAGAGGG - Intronic
1181988471 22:26818565-26818587 CTTTATAAGAAGCAGGCAGAGGG + Intergenic
1182191890 22:28469543-28469565 CCTTATAAGAGGGAGGCAGAGGG + Intronic
1183327049 22:37199922-37199944 CCTTCTGAAGAGCAGGCGCAGGG + Intergenic
1183952725 22:41360633-41360655 CTTTAAAAGGAGCTGGCGGGGGG + Intergenic
1183998012 22:41650606-41650628 TCTTCTAAGGAGCAGGAAGATGG - Intronic
1184304530 22:43587603-43587625 CCTTATAAGAGGGAGGCAGAGGG - Intronic
1184413121 22:44337268-44337290 CCTTATAAGAGGGAGGCAGAGGG - Intergenic
1185263529 22:49884944-49884966 CCTGAGAAGCAGCAGGCTGATGG + Exonic
949407874 3:3733756-3733778 CCTTACAAGAGGGAGGCGGAGGG - Intronic
950433677 3:12966443-12966465 CCTTCTGAGGAGCAGGGGGGTGG - Intronic
955636038 3:61030710-61030732 CCTTAGAGGGATCAGGAGGATGG + Intronic
955949886 3:64232534-64232556 CCTGAGAAGGAGCAGCCAGAGGG - Intronic
957682858 3:83460141-83460163 CCTTATAAGAGACAGGCAGAGGG + Intergenic
959516436 3:107272359-107272381 CCTTTTAAGGACTAGGCAGATGG - Intergenic
959872574 3:111345336-111345358 CCTTATGAGAAGCAGGCAAAGGG + Intronic
960173140 3:114486629-114486651 GCTTATAAGGACTAGGCTGAAGG + Intronic
965811885 3:172599898-172599920 CCTTATAAGGAGCAGGTGGAGGG - Intergenic
968076255 3:195817343-195817365 CCTTGTAAGGAGAAGGAGGCCGG - Intergenic
970076472 4:12227506-12227528 CCTTATTAGCAGCAGGAGAATGG - Intergenic
972258951 4:37388886-37388908 CCATATCAGGAGCTGGAGGAGGG - Intronic
973208604 4:47589044-47589066 CCTTATAAGAAAGAGGCAGAGGG + Intronic
975225482 4:71866357-71866379 CCTTATAAGGAAGAGACGTAAGG + Intergenic
975684058 4:76902341-76902363 ACTTAGAAGGAGCAGCTGGAGGG + Intergenic
976273402 4:83252213-83252235 TCTTCTAGGGAGCAGGGGGACGG + Intergenic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
984196155 4:176660314-176660336 CCTTATAAGGCAAAGGCAGAGGG - Intergenic
984924938 4:184798510-184798532 GCTTAGAAGGAGCAGGTGAAGGG + Intronic
986304362 5:6504534-6504556 CCTTATAAGAGGAAGGCAGAGGG - Intergenic
986367145 5:7043731-7043753 CCTTATAAGAGGGAGGCAGAGGG - Intergenic
990412487 5:55554655-55554677 CCTTATAAGTGGGAGGCAGAGGG + Intergenic
991433218 5:66569466-66569488 CCTTATAAGAGGGAGGCAGAAGG + Intergenic
992318750 5:75588820-75588842 CCTTATAAGAAGGAGGCAGGAGG - Intronic
993348673 5:86819535-86819557 GCTAATAAGGAGCAGGGCGAGGG - Intergenic
993558225 5:89368272-89368294 CCTTATAAGATGGAGGCAGAAGG - Intergenic
994255377 5:97587249-97587271 CCTGCTAAGAAGGAGGCGGAAGG + Intergenic
995098469 5:108269187-108269209 GCTTTTAAGGAGTAGGAGGAAGG + Intronic
998020733 5:138767886-138767908 CCTTTTAAAGAGCAGTCTGAGGG + Intronic
1000035653 5:157445726-157445748 CCTTATAAGTGGAAGGCAGATGG - Intronic
1001427972 5:171636811-171636833 CCTTATAAGAAAAAGGCAGAGGG + Intergenic
1002458809 5:179362224-179362246 CCTTATGAGGAGGAGGCAGAGGG - Intergenic
1002981157 6:2140216-2140238 CCTTATAAGAAACAGGCAGTGGG + Intronic
1003164601 6:3665267-3665289 GCTTATTAGGAGAAGGTGGAGGG - Intergenic
1005985188 6:30868671-30868693 CCATGTAAGAAGCAGCCGGATGG - Intergenic
1006658924 6:35622591-35622613 ACTTATAAGGAGCAGATGGATGG - Intronic
1009197057 6:60699422-60699444 CCTTATAAGGAGGAGGCAAAGGG - Intergenic
1010009828 6:71037070-71037092 CCTTATAAGAGGGAGGCAGAGGG + Intergenic
1010371434 6:75113904-75113926 CCTTCTAAGGAGAAGTCAGAAGG - Intronic
1010503944 6:76633447-76633469 CCCTAGAGGGAGCAGGCAGATGG + Intergenic
1011476673 6:87755444-87755466 CCTTATAAGAGGGAGGCAGAGGG - Intergenic
1013055384 6:106577745-106577767 CCTTATAAGGGGAAGGCAGGAGG + Intronic
1016396453 6:143628571-143628593 CCTTATAAGAGGGAGGCGAAGGG - Intronic
1017156926 6:151330856-151330878 CATTATATGGAGCTTGCGGATGG + Intronic
1022840190 7:34157062-34157084 CCATAAAAGGTGCAGGCTGAAGG + Intergenic
1025003910 7:55340870-55340892 CCTTATAAGAGGGAGCCGGAAGG - Intergenic
1026884977 7:73935484-73935506 CCTTATAAGAAATAGGCAGAGGG + Intergenic
1028839873 7:95417339-95417361 CTTTCTGAGGAGCAGGCAGATGG - Intronic
1029183339 7:98720455-98720477 CCTTATAAGTAGGAGACGGAGGG - Intergenic
1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG + Intergenic
1032669537 7:134070336-134070358 CCTAATTTGGCGCAGGCGGAAGG + Intergenic
1038324314 8:26561046-26561068 CCTTGAAAGAAGCAGGGGGAGGG + Intronic
1039648297 8:39311592-39311614 AATTATAAGGAGCAGCCTGATGG + Intergenic
1044476250 8:92629960-92629982 CCTTCAAAGGAGCAGGAGAATGG - Intergenic
1049693321 8:143972227-143972249 CCTTAGAGGGAGCACCCGGAGGG - Intronic
1051297402 9:15611120-15611142 CCAGATCAGGAGCAGGAGGAAGG - Intronic
1051686536 9:19663933-19663955 CCTTCTAATAAGCAGGTGGATGG + Intronic
1052989942 9:34513201-34513223 CCTTCTAAGGAGCTGGCACAGGG - Intronic
1053446598 9:38157959-38157981 CCTTATAAGAGGGAGGCAGAGGG - Intergenic
1058975915 9:110125439-110125461 CCTTTTAGGGAGCAGAGGGAGGG + Intronic
1059014114 9:110495394-110495416 CCTTATAAGGGGAAGGCAGGAGG + Intronic
1059295164 9:113263936-113263958 CCTTATAAGGAGCAGGCGGAGGG + Exonic
1059561285 9:115337059-115337081 CCTTATAAGAAGGAGGCAAAGGG - Intronic
1060541399 9:124432963-124432985 CCTTATAAGAGGGAGGCAGAGGG + Intergenic
1061496974 9:130980697-130980719 TCTAATGAGGAGCAGGTGGATGG - Intergenic
1203779042 EBV:90615-90637 CATTCTCAGGAGCAGGCTGAGGG + Intergenic
1186429533 X:9493068-9493090 ACTGATAAGAAGCAGGTGGAGGG - Intronic
1188472902 X:30560270-30560292 TCTTATAATGAGCAGGTGGCTGG - Exonic
1190256182 X:48764241-48764263 CCTTATGAGGAACAGGCTAAAGG + Intronic
1192551983 X:72061813-72061835 CCTGAGAAGGAGCTGGCAGAGGG - Intergenic
1196281552 X:113828774-113828796 CCTTAGAGGGTGCAGGCAGATGG - Intergenic
1198105601 X:133458397-133458419 CCTTATAAGAGAAAGGCGGAGGG - Intergenic
1199228940 X:145412223-145412245 CCTTATAAGGTGAAGGCAGGAGG - Intergenic
1199675739 X:150187803-150187825 CTTTATAAGGGGGAGGCAGAAGG - Intergenic
1199681636 X:150228714-150228736 CCTTATAAGAGGAAGGCAGAAGG - Intergenic
1199902968 X:152195705-152195727 CCTTATAAGAATCAGGCAGAAGG - Intronic