ID: 1059297841

View in Genome Browser
Species Human (GRCh38)
Location 9:113288182-113288204
Sequence TGGCCTTCAATATCTGCCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 112}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059297841_1059297846 5 Left 1059297841 9:113288182-113288204 CCAGTGGCAGATATTGAAGGCCA 0: 1
1: 0
2: 0
3: 15
4: 112
Right 1059297846 9:113288210-113288232 TGCGTGTGGCGCGGGTAATGTGG 0: 1
1: 0
2: 0
3: 4
4: 54
1059297841_1059297848 27 Left 1059297841 9:113288182-113288204 CCAGTGGCAGATATTGAAGGCCA 0: 1
1: 0
2: 0
3: 15
4: 112
Right 1059297848 9:113288232-113288254 GCATCCTTCAGGACGTTTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 81
1059297841_1059297842 -9 Left 1059297841 9:113288182-113288204 CCAGTGGCAGATATTGAAGGCCA 0: 1
1: 0
2: 0
3: 15
4: 112
Right 1059297842 9:113288196-113288218 TGAAGGCCATACAGTGCGTGTGG 0: 1
1: 0
2: 0
3: 8
4: 89
1059297841_1059297849 28 Left 1059297841 9:113288182-113288204 CCAGTGGCAGATATTGAAGGCCA 0: 1
1: 0
2: 0
3: 15
4: 112
Right 1059297849 9:113288233-113288255 CATCCTTCAGGACGTTTCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 121
1059297841_1059297843 -4 Left 1059297841 9:113288182-113288204 CCAGTGGCAGATATTGAAGGCCA 0: 1
1: 0
2: 0
3: 15
4: 112
Right 1059297843 9:113288201-113288223 GCCATACAGTGCGTGTGGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 38
1059297841_1059297845 -3 Left 1059297841 9:113288182-113288204 CCAGTGGCAGATATTGAAGGCCA 0: 1
1: 0
2: 0
3: 15
4: 112
Right 1059297845 9:113288202-113288224 CCATACAGTGCGTGTGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 44
1059297841_1059297847 16 Left 1059297841 9:113288182-113288204 CCAGTGGCAGATATTGAAGGCCA 0: 1
1: 0
2: 0
3: 15
4: 112
Right 1059297847 9:113288221-113288243 CGGGTAATGTGGCATCCTTCAGG 0: 1
1: 0
2: 0
3: 2
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059297841 Original CRISPR TGGCCTTCAATATCTGCCAC TGG (reversed) Exonic