ID: 1059297844

View in Genome Browser
Species Human (GRCh38)
Location 9:113288202-113288224
Sequence CCCGCGCCACACGCACTGTA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 36}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059297844_1059297849 8 Left 1059297844 9:113288202-113288224 CCATACAGTGCGTGTGGCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 36
Right 1059297849 9:113288233-113288255 CATCCTTCAGGACGTTTCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 121
1059297844_1059297848 7 Left 1059297844 9:113288202-113288224 CCATACAGTGCGTGTGGCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 36
Right 1059297848 9:113288232-113288254 GCATCCTTCAGGACGTTTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 81
1059297844_1059297851 18 Left 1059297844 9:113288202-113288224 CCATACAGTGCGTGTGGCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 36
Right 1059297851 9:113288243-113288265 GACGTTTCCTGGGCACCACCTGG 0: 1
1: 0
2: 0
3: 16
4: 109
1059297844_1059297847 -4 Left 1059297844 9:113288202-113288224 CCATACAGTGCGTGTGGCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 36
Right 1059297847 9:113288221-113288243 CGGGTAATGTGGCATCCTTCAGG 0: 1
1: 0
2: 0
3: 2
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059297844 Original CRISPR CCCGCGCCACACGCACTGTA TGG (reversed) Exonic