ID: 1059297848

View in Genome Browser
Species Human (GRCh38)
Location 9:113288232-113288254
Sequence GCATCCTTCAGGACGTTTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059297844_1059297848 7 Left 1059297844 9:113288202-113288224 CCATACAGTGCGTGTGGCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 36
Right 1059297848 9:113288232-113288254 GCATCCTTCAGGACGTTTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 81
1059297841_1059297848 27 Left 1059297841 9:113288182-113288204 CCAGTGGCAGATATTGAAGGCCA 0: 1
1: 0
2: 0
3: 15
4: 112
Right 1059297848 9:113288232-113288254 GCATCCTTCAGGACGTTTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059297848 Original CRISPR GCATCCTTCAGGACGTTTCC TGG Exonic