ID: 1059297949

View in Genome Browser
Species Human (GRCh38)
Location 9:113289041-113289063
Sequence CTTTAGAAGGGGGAGTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 571}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059297949 Original CRISPR CTTTAGAAGGGGGAGTTGGC TGG (reversed) Intronic
900657389 1:3766107-3766129 CTTTAGAAGGCTGAGGTGGGTGG - Intronic
900663040 1:3795661-3795683 CAGGAGAAGGGGGAGTTGGAAGG + Intronic
900988702 1:6087623-6087645 CTTGAGAAGGGAGAGTGGTCGGG + Intronic
901295044 1:8154663-8154685 CTTTAGAAGGCTGATTTGGCTGG - Intergenic
901416644 1:9121087-9121109 CTTTGGGAGGGCGAGGTGGCTGG + Intronic
901695788 1:11007013-11007035 CTTTAGAAGGCTGAGGTGGGTGG - Intergenic
902429664 1:16353084-16353106 CTTGAGAAGGGGGACTTTGCTGG - Intronic
902916012 1:19640009-19640031 CTTTAGGAGGCCGAGTTGGGTGG - Intronic
903066083 1:20700383-20700405 GTTTTGAAGGTGGAGATGGCAGG + Intronic
903290527 1:22311119-22311141 CTTTGGAAGGGCGAGGTGGGTGG + Intergenic
903365351 1:22802412-22802434 CCTAAGAATGGGGAGGTGGCAGG + Intronic
903506775 1:23841751-23841773 CTTTGGAAGGTGGAGGTGGGAGG + Intergenic
903598194 1:24512992-24513014 CTTTAGGAGGCCGAGTTGGGCGG + Intronic
903727122 1:25457353-25457375 CTTCAGAAGGTGGAGGTGGGAGG - Intronic
903750675 1:25618363-25618385 CCTTAGAGGGGGCAGTTGGTGGG - Intronic
904589028 1:31598158-31598180 CTTTGGAAGGCTGAGTTGGGAGG + Intergenic
905616946 1:39408283-39408305 CTTGAGAAGGGGGAGAGGGAAGG + Intronic
905736898 1:40335228-40335250 CTTTGGAAGGCTGAGTTGGGTGG + Intergenic
905746960 1:40426282-40426304 CTTTAGGAGGTAGAGTTGGGAGG + Intergenic
906018367 1:42603974-42603996 CTTTAGAAGGCTGAGGTGGGAGG + Intronic
906037359 1:42759823-42759845 CTTTAGGAGGCCGAGTTGGGAGG - Intronic
906394620 1:45451254-45451276 ATTTTGAAGTGGGAGTGGGCTGG + Intronic
906567899 1:46813650-46813672 TCTTAGAGGGGAGAGTTGGCAGG + Intronic
906598124 1:47098058-47098080 CTTTGGAAGGCCGAGTTGGGAGG - Intronic
907102493 1:51849571-51849593 CTTTGGAAGGTGGAGGTGGATGG + Intronic
907458246 1:54589728-54589750 CTTTAGAAGGCAGAGGTGGGAGG - Intronic
908394801 1:63715769-63715791 CTTAAGAACTGGAAGTTGGCCGG + Intergenic
909514829 1:76495619-76495641 CTTTAGGAAGGGGAGTTGGAGGG - Intronic
909630241 1:77763140-77763162 CTTTGGAAGGCCGAGTTGGGCGG + Intergenic
912283446 1:108342292-108342314 CTTTAGAAGGTTGAGGTGGGCGG + Intergenic
912843903 1:113062973-113062995 CTCGAGGAGGGGGATTTGGCAGG + Intergenic
913208644 1:116565005-116565027 GTTTTGAAGGTGGAGCTGGCAGG - Intronic
913375488 1:118146964-118146986 CATTAGCTGGGGTAGTTGGCAGG - Intronic
914253354 1:145940207-145940229 CTTTAGGAGGCGGAGTTGGGCGG - Intronic
914904714 1:151734465-151734487 ATTTAGGAAGGGGAATTGGCAGG + Intergenic
915125023 1:153657886-153657908 CTTTAGGAGGCTGAGTTGGGAGG + Intergenic
915404490 1:155649187-155649209 CTTTAGAAGGCCGAGGTGGGCGG - Intergenic
918127923 1:181600528-181600550 GTTTTGAAGGTGGAGCTGGCAGG + Intronic
918189539 1:182160414-182160436 CTTTAGAAGGCTGAGGTGGGAGG + Intergenic
918400823 1:184161224-184161246 ATTTTGAAGGTGGAGTTGTCAGG + Intergenic
918659433 1:187071706-187071728 CTTTAGAAATGGGCGTGGGCCGG - Intergenic
918840165 1:189525644-189525666 CTTTAGAAGGCTGAGGTGGGTGG + Intergenic
919342648 1:196333031-196333053 CTTTGGAAGGCCGAGATGGCAGG - Intronic
919819767 1:201465710-201465732 CTTGAGAAGGGGGAGCTGCTGGG - Exonic
920257470 1:204665381-204665403 CTTTGGAAGGCGGAGGTGGGAGG - Intronic
920291487 1:204926655-204926677 CTTTAGGAGGTGGAGGTGGGTGG - Intronic
920799533 1:209173789-209173811 CTTTTGAAGGAGGGGTAGGCAGG - Intergenic
920913984 1:210243695-210243717 GTTTAGCAGGAAGAGTTGGCTGG - Exonic
922675825 1:227548230-227548252 CATCAGAAGGAGGAGGTGGCAGG + Intergenic
922819998 1:228477825-228477847 CTTTAGAAGGCTGAGGTGGGAGG + Intergenic
922917921 1:229273494-229273516 CTTTGGAAGGCCGAGTTGGGCGG + Intronic
923141930 1:231167749-231167771 CTTAAGACGTGAGAGTTGGCTGG - Intronic
924020152 1:239772392-239772414 CTTTGGAAGGCCGAGGTGGCCGG - Intronic
924489086 1:244517526-244517548 CTTTAGGAGGAGGAGGTGGGTGG + Intronic
924695243 1:246392689-246392711 CTTTTGAAGGTGGAGGTGGGAGG - Intronic
1063243614 10:4195537-4195559 CTTTGGAAGGTGGAGGTGGGCGG + Intergenic
1063409181 10:5823705-5823727 CTTTAGAAGGCCGAGGTGGGTGG + Intronic
1063985470 10:11497164-11497186 CTTTGGAAGGGTGAGGTGGGGGG + Intronic
1064286805 10:13998705-13998727 ATCTAGAAGGGAGAGCTGGCAGG - Intronic
1064614211 10:17135759-17135781 TATTAGAGGGGGAAGTTGGCCGG + Intergenic
1064972777 10:21083003-21083025 CTTTGGAAGGCTGAGTTGGGTGG - Intronic
1065659436 10:27990417-27990439 CTTTGGAAGGTGGAGATGGAAGG - Intronic
1065712063 10:28528221-28528243 CTTTGGGAGGCGGAGGTGGCAGG + Intergenic
1065834114 10:29641325-29641347 CTTTGGAAGGCGGAGGTGGGAGG + Intronic
1066214748 10:33275323-33275345 CTTTAGAAGGCGGAGGTGGGTGG + Intronic
1066977542 10:42383237-42383259 CTTTAGGAGGCGGAGGTGGGCGG - Intergenic
1067025650 10:42841546-42841568 CTTTAGAAGGTCGAGGTGGGAGG + Intergenic
1068030920 10:51703893-51703915 CTTTGGAAGGCGGAGGTGGGTGG + Intronic
1068327363 10:55511114-55511136 CTTTGGAAGGCTGAGTTGGGAGG - Intronic
1070029400 10:72662441-72662463 CTTTGGGAGGGGGAGGTGGGTGG - Intergenic
1070052743 10:72905012-72905034 AGTGAGAAGGGGGAGGTGGCAGG + Intronic
1070223399 10:74474765-74474787 CTTTGGAAGGGCGAGTTGTGAGG - Intronic
1070720875 10:78756256-78756278 TTTTGGAAGGTTGAGTTGGCTGG - Intergenic
1071229672 10:83571029-83571051 CTTTAGGAGGGCGAGGTGGGAGG + Intergenic
1071537209 10:86443776-86443798 CTTTGGAAGGCTGAGTTGGAAGG + Intronic
1071688863 10:87793979-87794001 CTTTGGAAGGCTGAGTTGGGAGG + Intronic
1071730606 10:88244527-88244549 CTTTAGAGTGGGCAGATGGCAGG + Intergenic
1071794443 10:88990392-88990414 CTTTAGAAAGGGCAGGAGGCCGG + Intronic
1071968548 10:90878144-90878166 CTTCACAAGTGGGAGTGGGCAGG + Intronic
1072269700 10:93764327-93764349 CTTTGGAAGGGTGAGGTGGGAGG - Intronic
1072977336 10:100070169-100070191 CTTTGGAAGGGCGAGGTGGGTGG - Intronic
1073398399 10:103237319-103237341 CTTTAGGAGGGTGAGTCGGGAGG + Intergenic
1074089615 10:110236702-110236724 CTTTGGAAGGTAGAGGTGGCAGG - Intronic
1074106086 10:110390640-110390662 CTTCAGAAGGCGGAGATGGAAGG + Intergenic
1074132362 10:110592018-110592040 CTTTGGGAGGGGGAGGTGGGCGG + Intronic
1074917546 10:117971952-117971974 CTTTGGGAGGCGGAGGTGGCAGG + Intergenic
1075061129 10:119257478-119257500 CTTTGGAAGGCGGAGGTGGGTGG + Intronic
1075522406 10:123150861-123150883 CGTTAGGAGGGAGAGTGGGCGGG - Intergenic
1075597769 10:123744528-123744550 GTTCAGAAGGGGGAGTTGCAGGG - Intronic
1076033917 10:127182930-127182952 CATCAGAGGCGGGAGTTGGCAGG + Intronic
1077094976 11:795440-795462 CTTTAAAAGCCGGAGCTGGCTGG - Intronic
1077314321 11:1910489-1910511 CTTTGGAAGGCCGAGGTGGCTGG - Intergenic
1078176277 11:8973751-8973773 CTTTAGAAGGCTGAGGTGGGTGG - Intergenic
1078393999 11:10962889-10962911 CTTTAGAAGGCTGAGGTGGGTGG + Intergenic
1079216163 11:18513829-18513851 CTTTAGAAGGCCGAGATGGGTGG + Intronic
1081465289 11:43310653-43310675 CTTTGGAAGGCTGAGTTGGGTGG - Intergenic
1081880097 11:46442384-46442406 CTTTAGGAGGCTGAGTTGGGAGG - Intronic
1081899921 11:46618924-46618946 CTTTAGAAGGCTGAGGTGGGAGG - Intronic
1082035739 11:47643953-47643975 CTTTAGAAGGCTGAGGTGGGTGG + Intergenic
1082688020 11:56263086-56263108 CATTTGTAGGGTGAGTTGGCAGG + Intergenic
1083574793 11:63782469-63782491 CTTTGGAAGGCCGAGTTGGGTGG - Intergenic
1083790766 11:64984138-64984160 CTTTGGAAGGCTGAGGTGGCTGG + Intergenic
1084009032 11:66337607-66337629 CTTCAGGAGTGGGAGGTGGCAGG + Exonic
1084274698 11:68045289-68045311 CTCAACAAGGGGGAGTTGGCTGG - Intronic
1084431277 11:69112744-69112766 CTTTGGAAGGCTGAGTTGGGCGG + Intergenic
1084749070 11:71192102-71192124 CTTTAGGAGGGTGAGGTGGATGG - Intronic
1085083179 11:73649956-73649978 CTTTAGGAGGCTGAGTTGGGAGG + Intronic
1085096221 11:73762178-73762200 CTTTGGAAGGCTGAGTTGGGTGG + Intergenic
1085105214 11:73836440-73836462 CTTTAGAAGGGTGAGGTGGGAGG - Intronic
1085142134 11:74155842-74155864 CTTTAAAAGGGTGAATTGGCTGG + Intronic
1085586691 11:77714878-77714900 CTTTAGAAGGTTGAGGTGGGAGG + Intronic
1085652519 11:78281182-78281204 CTTTAGGAGGCTGAGTTGGGAGG - Intronic
1085689237 11:78652066-78652088 CTTTGGAAGGTGGGGTGGGCTGG + Intergenic
1085897529 11:80657561-80657583 ATTTTGAAAGGGGAGTCGGCAGG + Intergenic
1085947067 11:81284812-81284834 CTGTAGGAGGGGGAGAAGGCAGG - Intergenic
1089234413 11:117010874-117010896 CTTTGGAAGGCCGAGGTGGCTGG + Intronic
1089395995 11:118136572-118136594 CTTTGGAGGTGGGAGTGGGCTGG - Exonic
1089648209 11:119894123-119894145 CTGTAAAATGGGGAGTTGGGGGG + Intergenic
1089926281 11:122261704-122261726 CTTTAGGAGGCTGAGGTGGCAGG + Intergenic
1090461840 11:126897937-126897959 CTTGGGAAGGGGGAGTGGGTGGG + Intronic
1090781685 11:130012401-130012423 CTTTAGGAGGCGGAGGTGGGAGG + Intergenic
1090822531 11:130356694-130356716 CTTTAGAAGGCTGAGGTGGGAGG + Intergenic
1092382915 12:8012530-8012552 CTGCAGTAGGGGGAGTTGGGTGG + Intergenic
1092714624 12:11376132-11376154 CTTTGGGAGGGTGAGTTGGATGG - Intronic
1092718331 12:11415147-11415169 CTTTGGGAGGGTGAGTTGGATGG - Intronic
1093042752 12:14402839-14402861 CTTTGGAAGGGTGAGGTGGGTGG - Intronic
1093059215 12:14585195-14585217 CTTTGGGAGGCGGAGGTGGCCGG - Intergenic
1094593764 12:31845389-31845411 CTTTGGAAGGCCGAGGTGGCTGG - Intergenic
1095756082 12:45768668-45768690 CTGTAGAAGGGCTAGTTTGCTGG + Intronic
1096530527 12:52239771-52239793 CATTAGAGTGGTGAGTTGGCAGG - Intronic
1096691421 12:53324465-53324487 CCTGAGAAGGGGAAGTGGGCAGG + Intronic
1096823337 12:54254702-54254724 ATTTAGAAGGGCGTGGTGGCGGG + Intronic
1097186497 12:57199135-57199157 CTTGAGGAGGTGGAGTGGGCCGG + Intronic
1097239526 12:57565533-57565555 CTTTAGAAGGCTGAGGTGGGAGG + Intronic
1097532880 12:60827825-60827847 CTTTGGAAGGCTGAGTTGGGTGG - Intergenic
1097824349 12:64159220-64159242 CTTTAGAAGGCCGAGGTGGGTGG + Exonic
1097869201 12:64586079-64586101 CTTTGGGAGGGGGAGGTGGGTGG + Intergenic
1097976678 12:65693801-65693823 TTTTAAAAGGGAGATTTGGCTGG - Intergenic
1098660806 12:73091218-73091240 CATTAGAAGGTGGAGTTTCCAGG - Intergenic
1098793987 12:74865179-74865201 CTTTGGAAGGCCGAGGTGGCTGG + Intergenic
1099316394 12:81087760-81087782 CTTAAGGAGGGAGAGTTGGGAGG - Intronic
1100322500 12:93508942-93508964 CTTTAGGAGGCGGAGGTGGGCGG + Exonic
1100782719 12:98046604-98046626 CTTTAGAAGGCCGAGGTGGGAGG + Intergenic
1100825138 12:98467958-98467980 CTTTAGAAGGCGGAGGTGGGAGG - Intergenic
1102098271 12:110257680-110257702 CTTTAGAAGGCTGAGGTGGGTGG - Intergenic
1102875429 12:116445132-116445154 GTGTCCAAGGGGGAGTTGGCAGG + Intergenic
1102902494 12:116649077-116649099 CTTTGGAAGGTGGAGGTGGGAGG + Intergenic
1103291948 12:119853941-119853963 CTTTGGGAGGGGGAGATGGAAGG + Intronic
1103579570 12:121904329-121904351 CTTTAGGAGGGCGAGGTGGGTGG + Intronic
1103613553 12:122138401-122138423 CTGCAGAAGGGGCAGGTGGCTGG - Intronic
1103815159 12:123649209-123649231 CTTTGGAAGGCCGAGTTGGGTGG - Intronic
1104994963 12:132648576-132648598 CTTTAAATGGGTGAGTTGGATGG + Intronic
1105291153 13:19054528-19054550 CTTTAGAAGGCTGAGGTGGGTGG - Intergenic
1105561602 13:21497463-21497485 CTTTGGAAGGCTGAGGTGGCCGG + Intronic
1106253222 13:27999860-27999882 CTTTAGGAGGCGGAGATGGGAGG - Intergenic
1106256710 13:28029023-28029045 CTTTGGGAGGCGGAGTTGGGAGG - Intronic
1106300112 13:28456552-28456574 CTTTAGGAGGCGGAGGTGGGTGG + Intronic
1107303658 13:38994495-38994517 CTTTGGAAGGCTGAGTTGGGTGG - Intergenic
1107859310 13:44645889-44645911 CTTTAGGAGGCTGAGTTGGTTGG + Intergenic
1108045223 13:46377505-46377527 CTTTGGAAGGCCGAGTTGGGTGG - Intronic
1108740237 13:53330219-53330241 TTTTAGCAGGCAGAGTTGGCTGG - Intergenic
1109428107 13:62194306-62194328 ATTTAGAAGGGGGTGTTAACAGG + Intergenic
1109729333 13:66390490-66390512 CTTTAGGAGGCCGAGTTGGGTGG + Intronic
1109760911 13:66827569-66827591 ATTTTGAAGGTGGAGTTGGCAGG + Intronic
1110271490 13:73595967-73595989 CTTTGGAAGGGTGAGATGGGAGG + Intergenic
1111717385 13:91896360-91896382 CTTTGGGAGGCGGAGGTGGCTGG - Intronic
1111762159 13:92480041-92480063 CTTTAGGAGGTGGAGCTGGGAGG + Intronic
1111855012 13:93626556-93626578 CTTTAGGAGGTGGAGGTGGGTGG + Intronic
1111952447 13:94720113-94720135 CTTTAGAAGGCTGAGATGGGAGG - Intergenic
1112220775 13:97487473-97487495 CTTTAAAAGATGGAATTGGCTGG - Intergenic
1112594203 13:100792877-100792899 CTTTACAGGGTGGACTTGGCAGG + Intergenic
1112834493 13:103497633-103497655 CTTTATAAGAGGGAGGTGGAAGG - Intergenic
1113277076 13:108742235-108742257 CTTTGGGAGGCTGAGTTGGCTGG - Intronic
1115669935 14:35599499-35599521 CTTTGGGAGGGGGAGGTGGGAGG + Intronic
1116199677 14:41775330-41775352 CTTTGGAAGGCGGAGGTGGGCGG - Intronic
1117295242 14:54373027-54373049 ATTAAAAAGGGGGAGATGGCTGG - Intergenic
1118008108 14:61583450-61583472 CTTTGGAAGGCGGAGGTGGGAGG - Intronic
1118183380 14:63516090-63516112 CTTTAGGAGGCGGAGGTGGGCGG - Intronic
1118211948 14:63773442-63773464 CTTTAGAAGGGTGAGGCGGGTGG - Intergenic
1118382774 14:65230964-65230986 CTTTGGAAGGTGGAGGTGGGCGG + Intergenic
1118800516 14:69185317-69185339 CTTTAGAAGGCTGAGGTGGGAGG + Intergenic
1118899429 14:69974180-69974202 CTTGAGAGGGGGGAGTGGACTGG + Intronic
1119331558 14:73798638-73798660 CTTTATATGGGTGAGTTGGATGG + Intergenic
1119845453 14:77826185-77826207 CCTGGGAAGGGGGAGCTGGCTGG + Intronic
1120761335 14:88288449-88288471 ATTTGGAAGGGAGAGTTGGCTGG - Intronic
1120954346 14:90068349-90068371 CTTTGGGAGGGGGAGGTGGGTGG + Intronic
1121201290 14:92120793-92120815 CTTTGGAAGGCCGAGGTGGCCGG - Intronic
1121353798 14:93196179-93196201 CTTTGGGAGGGGGAGGTGGGAGG - Intronic
1121494732 14:94384360-94384382 CTTTTGAGGGAGGGGTTGGCAGG + Intronic
1121747233 14:96307166-96307188 CTTTAGAAGGCCGAGATGGGTGG + Intronic
1122995875 14:105263680-105263702 CTTTGGAAGGGTGAGATGGGCGG + Intronic
1123426271 15:20172890-20172912 CTTTAGAAGGTCGAGGTGGGAGG + Intergenic
1123535504 15:21179417-21179439 CTTTAGAAGGTCGAGGTGGGAGG + Intergenic
1123688959 15:22821206-22821228 CTTTGGAAGGGCGAGGTGGGCGG - Intronic
1123959623 15:25383391-25383413 CTTTAGAAGGGCAAGGTGGGTGG + Intronic
1124059517 15:26276651-26276673 CTTTAGGAGGTGGAGTTGGGAGG + Intergenic
1124526352 15:30457093-30457115 CTTTAGAAGGCCGAGGTGGTTGG - Intergenic
1124933126 15:34143229-34143251 CTTTGGGAGGGGGAGGTGGGTGG + Intronic
1125118574 15:36124966-36124988 CTTTAGATGGTGAAGTTTGCAGG - Intergenic
1125449390 15:39792302-39792324 CTTTGGGAGGGGGAGGTGGGAGG + Intergenic
1125691932 15:41602779-41602801 CTTTAGGAGGGTGAGGTGGTTGG - Intergenic
1125707074 15:41748011-41748033 CTTTGGAAGGCCGAGATGGCAGG + Intronic
1126210607 15:46097478-46097500 TTGGAGAAGGGGGATTTGGCAGG + Intergenic
1126765858 15:52010456-52010478 CTTTGGAAGGCCGAGTTGGGTGG - Intronic
1127185734 15:56478532-56478554 CTTTGGAAGAGGGAACTGGCTGG + Intergenic
1127952976 15:63828094-63828116 CTTTAAAAGGGTGAGTTGTATGG + Intronic
1128022003 15:64399864-64399886 CTTTGGAAGGCTGAGTTGGGAGG + Intronic
1128140121 15:65293764-65293786 CTTTGGAAGGCGGAGGTGGTCGG + Intronic
1129230410 15:74194084-74194106 CTCGAGAAGGGGAAGTGGGCAGG - Intronic
1129357945 15:75004931-75004953 CTTTGGAAGGCGGAGTTGGGCGG + Intronic
1129741640 15:77992384-77992406 CTGGAGCAGGGGGAGGTGGCGGG + Intronic
1129868835 15:78928269-78928291 GTTAAGAAGGGAGAGTTGGCCGG + Intronic
1131090903 15:89624429-89624451 CTTTAGAAGGGGGTGGAGGAGGG - Exonic
1132141574 15:99401339-99401361 TTATATAAGGGGGAGTTGCCGGG - Intergenic
1133289673 16:4711344-4711366 CTTTGGAAGGCCGAGTTGGGCGG - Intronic
1133934160 16:10255443-10255465 CTTTGGAAGGCGGAGGTGGGAGG - Intergenic
1134260007 16:12643530-12643552 CTTTAGAAGGCTGAGACGGCAGG + Intergenic
1135328033 16:21539998-21540020 CTTTAGATGGGAGAGTTGCATGG - Intergenic
1135791456 16:25400489-25400511 CTTTGGAAGGCTGAGTTGGGTGG - Intergenic
1136338386 16:29626022-29626044 CTTTAGATGGGAGAGTTGCATGG - Intergenic
1136357390 16:29754248-29754270 CTTTGGAAGGGTGAGGTGGGTGG - Intergenic
1136601964 16:31298122-31298144 CTTTGGAAGGCTGAGTTGGGAGG + Intronic
1136857977 16:33676607-33676629 CTTTAGAAGGTCGAGGTGGGAGG - Intergenic
1137268884 16:46889792-46889814 CTTCAGAAGGAAGACTTGGCAGG - Intronic
1138607963 16:58100573-58100595 CTTTAGGAGGGTGAGGTGGGAGG + Intergenic
1139460270 16:67116604-67116626 CTTTAGAAAGCGGAGGTGGGAGG + Intronic
1139519690 16:67473896-67473918 CTTTAGAAGGCCGAGTCGGGGGG - Intronic
1139585731 16:67902014-67902036 CTTTAGGAGGCGGAGGTGGGCGG + Intronic
1140110341 16:71998692-71998714 CTTTGGAAGGTGGAGGTGGATGG - Intronic
1140597294 16:76431434-76431456 CTTTGGAAGGTGGAGGTGGGGGG + Intronic
1140697382 16:77548515-77548537 CATAAGAAGAAGGAGTTGGCCGG + Intergenic
1141603622 16:85140846-85140868 CTTTGGGAGGACGAGTTGGCGGG - Intergenic
1141778973 16:86144012-86144034 ATTGAGGAGTGGGAGTTGGCAGG + Intergenic
1142041117 16:87894935-87894957 CTTTAGATGGGAGAGTTGCATGG - Intronic
1142143441 16:88482810-88482832 CTCTAGAAGGGGGAGGAGCCGGG + Intronic
1142401728 16:89862342-89862364 CTTAAGAAGTGGGCCTTGGCCGG - Intronic
1203119546 16_KI270728v1_random:1525082-1525104 CTTTAGAAGGTCGAGGTGGGAGG - Intergenic
1143465151 17:7131555-7131577 CTTTAGGGGTGAGAGTTGGCAGG + Intergenic
1143667874 17:8374701-8374723 CTTTAGGAGGCGGAGGTGGGCGG + Intronic
1144573118 17:16412838-16412860 CTTTGGGAGGCGGAGGTGGCCGG + Intergenic
1144844649 17:18210284-18210306 CTGGTGAAGGGGGAGATGGCAGG + Intergenic
1145029891 17:19496296-19496318 CTTTAGGAGGCGGAGGTGGGTGG + Intronic
1145954220 17:28843378-28843400 CTTTAGAAGGCTGAGGTGGGTGG - Intronic
1146016293 17:29236472-29236494 CTTTAGAAGGCTGAGGTGGACGG - Intergenic
1146739465 17:35269565-35269587 CCTTAGAAGGGAGAGGTGCCTGG + Exonic
1147112323 17:38272402-38272424 CTTTGGAAGGCTGAGTTGGGTGG - Intergenic
1147432370 17:40380228-40380250 CTTTGGAAGGCGGAGGTGGGAGG - Intergenic
1148325144 17:46779106-46779128 CTTTGGAAGGCCGAGTGGGCTGG - Intronic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149150899 17:53562429-53562451 CTTTGGAAGGCTGAGATGGCAGG + Intergenic
1149902540 17:60493575-60493597 CTTTAGAAGGCTGAGGTGGCAGG - Intronic
1150245241 17:63669856-63669878 CTTTAGGAGGCCGAGTTGGGTGG + Intronic
1150415564 17:64985768-64985790 CTTTAGAAGGCTGAGGTGGGAGG + Intergenic
1150796097 17:68238288-68238310 CTTTAGAAGGCTGAGGTGGGAGG - Intergenic
1151643211 17:75411683-75411705 CTTTAGGAGGTGGAGGTGGGTGG + Intergenic
1151833504 17:76569302-76569324 CTGTAGAAGGAGGACTTGGGGGG + Intronic
1152114477 17:78377035-78377057 CTTTGGAAGGCCGAGTTGGGTGG + Intergenic
1152183418 17:78839932-78839954 CTTTAGAAGGAGGAGGGAGCGGG - Intronic
1153236325 18:2991766-2991788 CTTTGGGAGGGGGAGGTGGGTGG + Intronic
1153314343 18:3707352-3707374 CTTTAGAAGGCCGAGGTGGGTGG + Intronic
1153829399 18:8908354-8908376 CTTTAAAAGGAGGTGTAGGCCGG + Intergenic
1153849473 18:9079677-9079699 CTTTAGTAGGCGGAGGTGGGAGG - Intergenic
1155165028 18:23225108-23225130 CTTTAGAAGGCCGAGGTGGGAGG - Intronic
1155751468 18:29427821-29427843 CTTTAGGAGGCTGAGGTGGCAGG - Intergenic
1158318366 18:56237091-56237113 CTTTGGGAGGGGGAGGTGGGTGG - Intergenic
1158823394 18:61187041-61187063 CTTTGGAAGGCGGAGGTGGGAGG + Intergenic
1159312608 18:66729132-66729154 CTTTGGGAGGCCGAGTTGGCTGG + Intergenic
1160034042 18:75285121-75285143 CTATAGGAGGGGTACTTGGCAGG + Intronic
1160603518 18:80032594-80032616 CTTTGGAAGGCCGAGTTGGGCGG + Intronic
1161071756 19:2265796-2265818 CTTTGGAAGGGTGAGATGGGTGG + Intronic
1161377962 19:3949925-3949947 CTTTGGAAGGCTGAGTTGGGAGG - Intergenic
1161475125 19:4480421-4480443 TCTTAGAAGTGGGAGTTGGGAGG + Intronic
1161566948 19:5008030-5008052 CTTTGGAAGGGTGGGTTGGGAGG + Intronic
1161629564 19:5345895-5345917 CTTTGGGAGGGGGAGGTGGGAGG - Intergenic
1161721655 19:5905936-5905958 CTTTGGAAGGGTGAGGTGGGAGG - Intronic
1161742282 19:6029462-6029484 CTTTGGGAGGGTGAGTTGGGTGG + Intronic
1161848757 19:6727780-6727802 CTTTATAAGAGGGAGGTGGGAGG - Intronic
1162146278 19:8613928-8613950 CTTTAGAAGGCTGAGGTGGGCGG - Intergenic
1162340644 19:10089714-10089736 CTTGGGATGGGGGAGTTGGGAGG + Intronic
1162657444 19:12141535-12141557 CTTTGGGAGGGCGAGGTGGCTGG + Intronic
1162945587 19:14041442-14041464 CTTTAGGAGGTGGAGGTGGGTGG - Intronic
1162981104 19:14240563-14240585 CTTTAGGAGGTGGAGGTGGGAGG - Intergenic
1163320759 19:16573149-16573171 CTGCAGAAGGGGGAGGTGCCGGG + Intronic
1163637894 19:18445871-18445893 CTATAGCAGGGGGAGGTGACAGG - Intronic
1165396335 19:35565753-35565775 CATTAGAAGGAGGACTGGGCCGG + Intergenic
1165533733 19:36425562-36425584 CTTTAGGAGGTGGAGATGGGTGG - Intergenic
1166048005 19:40241029-40241051 CTTTAGAAGGCTGAGGTGGGAGG - Intronic
1166421724 19:42641482-42641504 ACTCAGAAGGGGGAGTTGGGAGG - Intronic
1166645242 19:44526631-44526653 CTTTGGAAGGCGGAGGTGGGTGG + Intronic
1166821121 19:45580857-45580879 CTTTGGAAGGCGGAGGTGGGTGG - Intronic
1167370455 19:49078005-49078027 CTTTAAAAGAGGGACGTGGCTGG + Intergenic
1167825012 19:51964522-51964544 CTTCATAAGGGGCAGTTGGTGGG - Exonic
1168625810 19:57916847-57916869 CTTTGGAAGGCGGAGGTGGGCGG + Intergenic
925013168 2:501395-501417 TTTAAGAAGGGGGACTTGTCAGG - Intergenic
925459853 2:4051540-4051562 CTTTGGAAGGTGGAGGTGGAAGG + Intergenic
925661277 2:6205668-6205690 CTTTGGGAGGGCGAGGTGGCTGG + Intergenic
925963131 2:9037701-9037723 TTTTATAAAGGGGAGTTGCCGGG - Intergenic
926128786 2:10287309-10287331 CTCTAGAAGGGGAAGAGGGCAGG + Intergenic
926184702 2:10680029-10680051 CTTTGGAAGGGCGAGTTGGGCGG + Intronic
926306556 2:11641137-11641159 TTTTTGGGGGGGGAGTTGGCGGG + Exonic
926737290 2:16083213-16083235 CTTTAGCAGGGGGACCTGCCTGG - Intergenic
927547270 2:23965122-23965144 CTTTAGGAGGCGGAGGTGGGAGG - Intronic
927839177 2:26427357-26427379 CTTTGGAAGGTGGAGGTGGGTGG - Intronic
928722049 2:34132556-34132578 CTCGAGGAGGGGGATTTGGCAGG + Intergenic
930083824 2:47478038-47478060 CTTTGGAAGGCGGAGGTGGGAGG - Intronic
930125357 2:47792087-47792109 CTTTGGTAGGGGGAGGTGGGTGG - Intronic
930262989 2:49169190-49169212 ATTTGGAAGGGAGAGTTGGATGG - Intergenic
931440149 2:62284280-62284302 CTTTGGAAGGCTGAGATGGCCGG + Intergenic
931472224 2:62549729-62549751 CTTTGGAAGGTCGAGTTGGGTGG - Intergenic
932296617 2:70629163-70629185 CTTTAGGAGGTGGAGGTGGGTGG + Intronic
932912857 2:75822511-75822533 CTTTGGAAGGTGGAGGTGGGTGG - Intergenic
935018390 2:99206143-99206165 CTTTAGAAGGCTGAGGTGGGTGG - Intronic
935175564 2:100645768-100645790 GTTAAGAAGAGGGAGTTGGATGG - Intergenic
936100112 2:109570010-109570032 TTTTTGTAGGGGCAGTTGGCAGG - Intronic
937584186 2:123525968-123525990 CTTTGGAAGGTGGAGGTGGGAGG - Intergenic
937983695 2:127629124-127629146 CTTCAGAAGGGGGTGCTGGTTGG + Intronic
938044619 2:128106791-128106813 CTTTGGAAGGGGCAGGTGGGTGG - Intronic
938074893 2:128326535-128326557 CTGCAGAAGAGGGAGGTGGCAGG + Intergenic
938133144 2:128734398-128734420 ACTTAGGAGGGGGAGTTGGCAGG - Intergenic
939480792 2:142744689-142744711 CTTTAGAAGGCCGAGGTGGGTGG - Intergenic
939685107 2:145189331-145189353 CTTTAGGAGGCGGAGGTGGGCGG + Intergenic
940145300 2:150539689-150539711 CTATAGAAACGGGATTTGGCTGG - Intergenic
940434969 2:153640533-153640555 CTTTGGAAGGGTGAGGTGGGAGG + Intergenic
940860128 2:158762606-158762628 CTTTTGATGGGGGTGGTGGCAGG - Intergenic
940922433 2:159323557-159323579 CTTTAGGAGGTGGAGGTGGGCGG + Intronic
941108258 2:161387391-161387413 ATTTTGAAGGGGGAGTTAGCTGG + Intronic
942466613 2:176214746-176214768 CTTTAGAAGGCCAAGGTGGCCGG - Intergenic
942720097 2:178941707-178941729 CTTTAGAAGGCTGAGGTGGGAGG + Intronic
942820262 2:180105391-180105413 CTTTTGGAGAGGGATTTGGCTGG + Intergenic
942953859 2:181751462-181751484 CTTTAGCAGGCTGAGGTGGCTGG + Intergenic
943220759 2:185102570-185102592 CTTTAGGAGGTGGAGGTGGATGG + Intergenic
944079312 2:195769304-195769326 CTTTAGGAGGCTGAGTTGGGAGG - Intronic
945402843 2:209407562-209407584 CTTTAGAAGGCTGAGGTGGGAGG + Intergenic
945745029 2:213710023-213710045 CTTTAGAAGGCCGAGGTGGGCGG + Intronic
946728714 2:222688052-222688074 TTTTTGAAGGGGGAGGTGGAAGG - Intronic
947184515 2:227443275-227443297 CTTTGGGAGGCGGAGTTGGGTGG + Intergenic
947221880 2:227801782-227801804 CTTTAGGAGGCTGAGTTGGGAGG + Intergenic
947771775 2:232675930-232675952 CTTTAGGAGGGTGAGGTGGGAGG + Intronic
948682132 2:239642260-239642282 TGTGAGAAGGGGGAGTTGTCAGG + Intergenic
948682248 2:239643201-239643223 TGTGAGAAGGGGGAGTTGTCAGG + Intergenic
1169875629 20:10294172-10294194 TTTTAGAAGGGGGAAGTGGGAGG - Intronic
1170622129 20:18005099-18005121 CTTTGGAAGGCTGAGTTGGGTGG - Intronic
1171497688 20:25568652-25568674 CTTTGGAAGGCTGAGGTGGCAGG - Intronic
1172423073 20:34834232-34834254 CTTTGGGAGGGTGAGTTGGGTGG - Intergenic
1172693731 20:36807713-36807735 CTTAACAAGAGGGAGTAGGCTGG - Intronic
1173152498 20:40579585-40579607 GTTTAGATGGTGGAGATGGCAGG - Intergenic
1173540027 20:43844197-43844219 ATTGAGAAGGGGGAGTCTGCAGG + Intergenic
1173824119 20:46036570-46036592 CTTGAGAAGAAGGACTTGGCAGG + Intronic
1174230849 20:49044637-49044659 CTTTAGGAGGCGGAGGTGGGAGG + Intergenic
1174433530 20:50488930-50488952 CTTTAGAAGCTGGAAATGGCAGG - Intergenic
1174883327 20:54304490-54304512 CTTTGGAAGGTGGAGGTGGGTGG - Intergenic
1175112818 20:56660779-56660801 CTTTGGAAGGCGGAGGTGGGAGG - Intergenic
1175118697 20:56702231-56702253 CTTTAGAAGTGGGGGGTGGGGGG - Intergenic
1175125489 20:56748327-56748349 CTTTAGAAGGCCGAGGTGGGTGG - Intergenic
1175545975 20:59778098-59778120 CCAGAGAAGAGGGAGTTGGCTGG - Intronic
1175931534 20:62496065-62496087 CCCTACAAGGGGGAGTGGGCGGG - Intergenic
1176698292 21:10007990-10008012 CTTTAGAACTGGCACTTGGCTGG + Intergenic
1176873705 21:14104951-14104973 GTTTAGAAAGGGGAGGTGGGGGG - Intergenic
1177068842 21:16475904-16475926 CTTGAGAAGGGCGTGGTGGCGGG - Intergenic
1177492633 21:21847633-21847655 CTTTAGAAGGCTGAGATGGGAGG - Intergenic
1177663106 21:24113551-24113573 CTCCAGAAGAGGGAGTTGGGGGG + Intergenic
1178798638 21:35770299-35770321 CTTTGGAGGGTGGAGTTGGGAGG + Intronic
1180684528 22:17654965-17654987 CTTTAGAAGGCCGAGGTGGGAGG - Intronic
1180745876 22:18088533-18088555 CTTTGGAAGGGTGAGGTGGGTGG + Exonic
1181004845 22:20008400-20008422 CCTTAGGAGGGGGAGCTGGGAGG - Intronic
1182241541 22:28920207-28920229 CTTTGGGAGGGGGAGGTGGGTGG - Intronic
1182880710 22:33730936-33730958 CTTTAGGAGGTGGAGGTGGGTGG - Intronic
1183476801 22:38040028-38040050 CTTTAGTAGGGTGAGGTGGGAGG + Intronic
1183572442 22:38663776-38663798 CTTTAGGAGGCGGAGGTGGGTGG + Intronic
1184972274 22:48033209-48033231 CTTTGGAAGGGTGAGGTGGATGG - Intergenic
949560894 3:5201444-5201466 ATTAAGAAAAGGGAGTTGGCTGG - Intronic
949977800 3:9476809-9476831 CTTGGGAAGGGGGAGTAGGATGG - Exonic
950712056 3:14819831-14819853 CCTGAGAAGGAGGAGCTGGCCGG + Exonic
950791590 3:15476735-15476757 GTTGAGAAGGTGGTGTTGGCTGG - Intronic
952247279 3:31607841-31607863 CTTTGGAAGGCGGAGGTGGGAGG - Intronic
954027699 3:47796102-47796124 CTTTAGAAGGCCGAGGTGGGCGG + Intergenic
954032288 3:47828214-47828236 CTTTAGGAGGCGGAGTAGGGAGG + Intronic
954042403 3:47898701-47898723 CTTTAGAAGGGTTAGGTGGGAGG + Intronic
954524381 3:51256836-51256858 CTTTGGAAGGTGGAGGTGGGTGG - Intronic
955138542 3:56245782-56245804 CTTTAGGAGGCCGAGTTGGGTGG - Intronic
955501158 3:59584365-59584387 CTTTAGAAGGCTGAGGTGGGTGG + Intergenic
955519446 3:59760920-59760942 CTTTAGGAGGCGGAAGTGGCTGG - Intronic
955683384 3:61525948-61525970 CTTTGGAAGGGTGAGGTGGGAGG - Intergenic
956121978 3:65975510-65975532 CTTTGGAAGGTGGAGGTGGGCGG + Intronic
956443574 3:69304047-69304069 CTTTAGGAGGCTGAGTTGGGAGG + Intronic
957570964 3:81947116-81947138 CTTTAGGAGGGCGAGGTGGATGG + Intergenic
957823262 3:85406950-85406972 CTTTGGAAGGCGGAGGTGGGAGG + Intronic
958630862 3:96681776-96681798 CTTTAGAAGGTTGAGATGGGGGG - Intergenic
960352878 3:116615072-116615094 CTTAGGAAGGGTGAGATGGCTGG - Intronic
960715396 3:120569866-120569888 CTTTAGAAGGCTGAGGTGGGTGG + Intergenic
960876418 3:122300176-122300198 CTTTGGAAGGCCGAGTTGGGCGG + Intergenic
960946652 3:122971459-122971481 CTTGAGAAGGGAGATGTGGCAGG + Intronic
961528181 3:127521578-127521600 CTTTAGGAGGCCGAGATGGCTGG - Intergenic
962352774 3:134667711-134667733 CTTGAGAAGGCAGAGATGGCTGG + Intronic
962387941 3:134948035-134948057 CTTTGGAAGGGTGAGGTGGGAGG - Intronic
963063104 3:141241030-141241052 CTTTGGAAGGTTGAGTGGGCAGG - Intronic
963157616 3:142116306-142116328 CTTTGGAAGGCTGAGTTGGGAGG - Intronic
963413649 3:144964687-144964709 CTTTGGAAGGCGGAGGTGGGCGG - Intergenic
964600082 3:158490325-158490347 CTTTGGAAGGGTGAGGTGGGTGG - Intronic
964752859 3:160068300-160068322 CTTTAGAAGGCTGAGTTGGGTGG - Intergenic
965266662 3:166552296-166552318 CTTTGGAAGGTGGAGGTGGGCGG + Intergenic
965725749 3:171713310-171713332 CTTTAGTCGGGGGTGGTGGCAGG + Intronic
967065771 3:185913981-185914003 CCTTAGAAGGTGAAGTTGGCAGG - Intergenic
967092335 3:186145717-186145739 CTTAAGAATGGAGACTTGGCCGG + Intronic
967649159 3:191964141-191964163 CTTTGGAAGGCTGAGTTGGGTGG - Intergenic
967735624 3:192948886-192948908 CTTTAGGAGGCGGAGGTGGGCGG + Intergenic
967944631 3:194793944-194793966 CTTTGGGAGGCGGAGGTGGCAGG + Intergenic
968217038 3:196901286-196901308 CTTTGGGAGGGGGAGGTGGGCGG - Intronic
968686613 4:1963768-1963790 CTTTGGAAGGCCGAGTTGGGAGG + Intronic
969562664 4:7959502-7959524 CTCTGGAAGGTGGAGTTGGGAGG + Intergenic
971162478 4:24147485-24147507 CTTCAGAAGGGGCTGTGGGCAGG - Intergenic
972346453 4:38196515-38196537 CAGGAGAAGGGGGAGTTGGAGGG + Intergenic
972469457 4:39389713-39389735 CTTTAGGAGGTGGAGATGGAAGG - Intergenic
972547223 4:40091850-40091872 CTTTAGGAGGCTGAGTTGGGAGG - Intronic
972672912 4:41231103-41231125 CTTTGGGAGGTGGAGGTGGCAGG + Intergenic
973087993 4:46092816-46092838 CTTTAGAAGGCCGAGGTGGGTGG + Intronic
975180535 4:71339213-71339235 CTTTAGATTGGGGATTTGGGAGG + Intronic
975195707 4:71520963-71520985 CTTTGGAAGGCTGAGTTGGGAGG - Intronic
975555977 4:75664911-75664933 CTTTGGGAGGTGGAGGTGGCAGG + Intronic
978428470 4:108606721-108606743 CTTTAGGAGGGTGAGGTGGGTGG - Intergenic
978495783 4:109357933-109357955 CTTTGGGAGGAGGAGTTGGGCGG + Intergenic
978842637 4:113232818-113232840 CATAAGAAGTGGGAGTGGGCAGG + Intronic
979473212 4:121125270-121125292 CTTTTAAAGGGAGAGTGGGCAGG - Intergenic
979846864 4:125524634-125524656 CTTTAGAAGGCTGAGGTGGGAGG + Intergenic
980051063 4:128040959-128040981 CTTTGGGAGGCGGAGGTGGCTGG + Intergenic
980370838 4:131867813-131867835 CTTTAGAACTGGCACTTGGCTGG + Intergenic
980956273 4:139432187-139432209 CTTTAGGAGGTGGAGGTGGGTGG - Intergenic
981763504 4:148220329-148220351 CTTTGGAAGGCTGAGGTGGCAGG - Intronic
981956395 4:150479038-150479060 CTTTAGGAGGCTGAGGTGGCAGG + Intronic
981986418 4:150862731-150862753 CTTTAGGAGGTGGAGGTGGGTGG + Intronic
982329542 4:154165739-154165761 CTTTGGAAGGTGGAGGTGGGTGG + Intergenic
983730347 4:170985765-170985787 CTTTTGGAGGGGGAGGTGGGTGG - Intergenic
984769313 4:183423677-183423699 CTTTAGAAGGCTGAGGTGGGTGG - Intergenic
985287853 4:188355420-188355442 TTTTGGAAGGGAGAGGTGGCAGG - Intergenic
985653449 5:1117826-1117848 CTTTAGAAGGCTGAGGTGGGTGG + Intergenic
985989241 5:3541786-3541808 CTTTAGAAGGCTGAGGTGGGTGG + Intergenic
986177828 5:5366904-5366926 CTTTGCAAGGGGGAGTAGCCTGG - Intergenic
986732947 5:10648885-10648907 CTTTGGAAGGCGGAGGTGGGAGG + Intronic
987155857 5:15089248-15089270 CTTTAGTAGGGTGAGGTCGCGGG - Intergenic
988450600 5:31339126-31339148 CTTTGGGAGGTGGAGATGGCCGG + Intergenic
988562848 5:32296554-32296576 CTTTGGAAGGGTGAGGTGGTGGG + Intronic
988980654 5:36564779-36564801 CTTTGGAAGGTGGAGGTGGGTGG + Intergenic
989050796 5:37317794-37317816 CTTTGGAAGGCTGAGTTGGGAGG - Intronic
990413504 5:55564161-55564183 CTTTAGAAGGCTGAGATGGGAGG - Intergenic
990414602 5:55574248-55574270 CTTTAGGAGGTGGAGGTGGGTGG - Intergenic
990632311 5:57683939-57683961 CCTTAAGAGGGGGAATTGGCTGG + Intergenic
992186200 5:74246997-74247019 CATTAGAAGGAGGCGTTGGCGGG + Intergenic
992944363 5:81795204-81795226 CTTTAGAAGGGAGAGGTAGGTGG - Intergenic
994210032 5:97077364-97077386 CTTTAGAAGGCCGAGGTGGGTGG + Intergenic
996441537 5:123496810-123496832 CTTTGGAAGGCTGAGTTGGAAGG - Intergenic
996703650 5:126475067-126475089 CTTTAGAAGGGGAACTTGATTGG - Intronic
997006390 5:129821454-129821476 CTTTGGGAGGGTGAGTTGGGAGG - Intergenic
997293036 5:132751181-132751203 CTTTAGAAGTGGGAGTCTGGTGG - Exonic
997313672 5:132913683-132913705 CTTTAGAAGGCTGAGGTGGGAGG - Intronic
998102313 5:139444669-139444691 CTTTGGAAGGCTGAGGTGGCCGG + Intergenic
998435165 5:142101864-142101886 CTTTGGGAGGGGGAGGTGGGTGG + Intergenic
999162045 5:149509645-149509667 CTTTAGAAGGCCGAGGTGGGCGG - Intronic
999265623 5:150265064-150265086 TTTGAGAAGGGGGAGATGGAGGG - Intronic
999623491 5:153495838-153495860 CTTTGGAAGGGGCATTTGGTTGG + Intronic
999666725 5:153920498-153920520 CTTTAGAAGGGGGTTTGAGCAGG - Intergenic
999759239 5:154687724-154687746 CTTTGGAAGGCGAAGGTGGCAGG + Intergenic
1000380918 5:160628582-160628604 CTTCAGAAGGGTGGGGTGGCGGG + Intronic
1001195758 5:169672302-169672324 TTTTAAAAGGGGTAGTAGGCCGG - Intronic
1001953221 5:175830482-175830504 CTTTAGGAGGGGGAGTTTTAGGG + Intronic
1002146343 5:177185222-177185244 CTTTAGGAGGGCGATTTGGGTGG + Intronic
1003119193 6:3306143-3306165 CAATAGAAGGGGGAGGTGACAGG + Intronic
1004691402 6:17995390-17995412 CTTTGGAAGGGTGAGGTGGGTGG - Intergenic
1005004078 6:21270534-21270556 CTTTGGGAGGGAGAGTTGGGGGG - Intergenic
1005149776 6:22735555-22735577 CTTTAGGAGGCTGAGTTGGGAGG - Intergenic
1005801553 6:29430266-29430288 CTTTAGAGACGGGAGTTGGAGGG - Intronic
1006493246 6:34402213-34402235 CTTTGGAAGGCCGAGTTGGGTGG + Intronic
1006648612 6:35532924-35532946 CTTTGGAAGGTGGAGGTGGGAGG - Intergenic
1007785674 6:44277922-44277944 CTTTAGCCAGGGGAGTTGGCAGG - Exonic
1009397754 6:63220408-63220430 CTTTGGAAGGCCGAGTTGGGCGG - Intergenic
1010684080 6:78831449-78831471 CTTTAGAAGGCCGAGGTGGGTGG - Intergenic
1010885138 6:81227750-81227772 CATTAAAATTGGGAGTTGGCCGG + Intergenic
1011028115 6:82891780-82891802 CTTTAGAAGGCTGAGGTGGGTGG + Intergenic
1011048033 6:83108419-83108441 CTTTGGAAGGCGGAGGTGGGAGG - Intronic
1011611462 6:89155531-89155553 CTTTAGAAGGCCGAGGTGGGTGG - Intronic
1011798076 6:90979612-90979634 ATTTAAAAGGTGGAGTTGACAGG - Intergenic
1013319615 6:108974568-108974590 CTTTAGAAGGCGGAGTGGGGAGG + Intergenic
1013876980 6:114843829-114843851 CTTTAGGAGGTGGAGGCGGCTGG + Intergenic
1014022557 6:116607993-116608015 CTTTGGGAGGCGGAGTTGGGCGG + Intergenic
1014214627 6:118741051-118741073 CTTTGGAAGGCTGAGTTGGGTGG - Intergenic
1014507143 6:122273365-122273387 CTTTGGAAGGCGGAGATGGGCGG + Intergenic
1015367201 6:132409451-132409473 CTTTAGAAGGTTGAGGTGGGAGG + Intergenic
1015812327 6:137173126-137173148 CTTTGGAAGGCGGAGGTGGGTGG + Intronic
1018351732 6:162966717-162966739 CTTTGGGAGGGGGAGGTGGGTGG - Intronic
1018496444 6:164351178-164351200 CTTAAGAAGGAGGAGTGGGAGGG + Intergenic
1019718908 7:2555992-2556014 CTTTAGGAGGCGCAGTTGGGAGG + Intergenic
1019985133 7:4650149-4650171 CTTTAGAAGGTTGAGGTGGGAGG - Intergenic
1020156310 7:5727481-5727503 CTTTAGGAGGTGGAGGTGGGAGG + Intronic
1020360228 7:7319941-7319963 CTTTAGAAGGCCGAGATGGGCGG + Intergenic
1021585784 7:22206456-22206478 CTTTAGGAGGGTGAGTTGGGAGG + Intronic
1021712283 7:23427626-23427648 CTTTGGAAGGCGGAGGTGGGTGG + Intronic
1021794644 7:24241834-24241856 CTTTACAAGGGGGGCTTGGATGG + Intergenic
1024518522 7:50282684-50282706 CTTTAGAAGGCCGAGGAGGCAGG - Intergenic
1026277244 7:68890850-68890872 CTTTGGAAGGCTGAGGTGGCAGG + Intergenic
1026645190 7:72161356-72161378 CTTTAGAAAGGAGAATTGACAGG - Intronic
1026729014 7:72895069-72895091 CTTTGGAAGGTGGAGGTGGGAGG - Intronic
1026821763 7:73554552-73554574 CTTTAGAAGGCTGAGGTGGGTGG + Intronic
1027411262 7:77920926-77920948 CTTTAGAAGGCTGAGGTGGGTGG - Intronic
1028478657 7:91279969-91279991 GTTTATAAGAGGGAGTTTGCTGG - Intergenic
1028617943 7:92791129-92791151 ATTTAGGAGGTTGAGTTGGCAGG + Intronic
1029164102 7:98573782-98573804 CTTTAGGAGGGTGAGGTGGGCGG + Intergenic
1029556150 7:101270649-101270671 CTTTAGAAGGCAGAGGTGGGTGG + Intergenic
1029837943 7:103332865-103332887 CTTTAGAAGGCTGAGGTGGGTGG - Intronic
1030276705 7:107728720-107728742 CTTTAACAGGTGGAGTTGGGAGG + Intergenic
1030391772 7:108937405-108937427 CTTTAGAAATGGGAGTTTGTAGG - Intergenic
1030706206 7:112696691-112696713 CTCTAGGAGGGGGATTTGGCAGG + Intergenic
1032169454 7:129572431-129572453 ATTTAGAAGGGGGTGGTGGTGGG + Intergenic
1033149656 7:138902379-138902401 CTGAAGCAGGGGGTGTTGGCTGG - Intronic
1035518785 8:259497-259519 TGGTAGAAGGGGGAGCTGGCAGG - Intergenic
1035519002 8:261418-261440 CTTTAGAAGGCTGAGTCGGGAGG + Intergenic
1035624674 8:1061887-1061909 CTTTATAAGAGTGAGTGGGCAGG - Intergenic
1035734704 8:1879794-1879816 CTTTAGGAGGCGGAGGTGGGAGG - Intronic
1036440368 8:8776585-8776607 CTTTGGGAGGCGGAGGTGGCTGG + Intergenic
1036491696 8:9232405-9232427 CTTTAGAAGGCGGAGGTAGTAGG - Intergenic
1036948513 8:13118983-13119005 CTTTGGGAGGGAGAGTTGGGTGG + Intronic
1037688713 8:21165104-21165126 GTTTAGAAGGTGGAATTTGCAGG + Intergenic
1037903910 8:22704141-22704163 CTCCAGAAGGGAGAGTTGGGGGG - Intergenic
1037958435 8:23077108-23077130 CTTTAGAAGGCTGAGGTGGGTGG + Intergenic
1038642450 8:29338946-29338968 CTTTAGGAGGCTGAGGTGGCAGG + Intronic
1038696460 8:29811074-29811096 CTTTGGAAGGGTGAGGTGGGTGG - Intergenic
1039938159 8:42066152-42066174 CTTTGGAAGGGTGAGGTGGGTGG - Intergenic
1040490605 8:47918074-47918096 CTTTAGGAGGGTGAGGTGGGTGG - Intronic
1041243109 8:55866027-55866049 CTTTAGAAGGCCAAGGTGGCAGG + Intergenic
1041392191 8:57356964-57356986 CTTTAGAAGGCTGAGATGGGTGG - Intergenic
1041777630 8:61540847-61540869 CTTTAGGAGGCGGAGGTGGGTGG + Intronic
1042588799 8:70374226-70374248 CTTTAGAAGGCTGAGGTGGGCGG + Intronic
1042734605 8:71974297-71974319 CTTTGGAAGGCCGAGGTGGCTGG + Intronic
1043215716 8:77584737-77584759 CTTTAGGAGGCCGAGTTGGATGG + Intergenic
1044363034 8:91310437-91310459 CTGTAGAAGGGTGATTTGGCAGG + Intronic
1044978616 8:97692619-97692641 CTTTAGAAGGCCGAGGTGGGTGG - Intronic
1045097934 8:98817496-98817518 CTTTAGAAGAGGAAGTGGGTAGG - Intronic
1045140342 8:99273539-99273561 CTTTGGAAGGCTGAGTTGGGTGG + Intronic
1045308830 8:100982732-100982754 CTTTGGAAGGCTGAGTTGGGAGG + Intergenic
1045440341 8:102202543-102202565 CTTTAGGAGGCCGAGTTGGGCGG + Intergenic
1046315173 8:112491409-112491431 CTTTAGAAAGTGGAGGTGGATGG + Intronic
1047759094 8:127940843-127940865 CTTTAGAAGGCCGAGGTGGGAGG - Intergenic
1048335831 8:133501502-133501524 CTTTAGAAGGTCGAGGTGGGCGG + Intronic
1049081500 8:140446773-140446795 CTTTGGAAGGCGGAGGTGGGTGG - Intronic
1049496555 8:142938090-142938112 CTTTAGGAGGGCCAGTTGGCAGG + Intergenic
1050781868 9:9346934-9346956 CTTTAGAAGGCCGAGGTGGGCGG - Intronic
1051280786 9:15441436-15441458 CTCGAGGAGGGGGATTTGGCAGG + Intronic
1051290526 9:15541053-15541075 ATTTAGGAGGGTGAGTTGGGAGG - Intergenic
1052776538 9:32738747-32738769 CTTTTTCAGAGGGAGTTGGCAGG - Intergenic
1053042343 9:34885367-34885389 CATCAGAAGGAGGAGGTGGCAGG - Intergenic
1053635417 9:39994331-39994353 CTTTAGAACTGGCACTTGGCTGG + Intergenic
1053770513 9:41469969-41469991 CTTTAGAACTGGCACTTGGCTGG - Intergenic
1054208470 9:62256367-62256389 CTTTAGAACTGGCACTTGGCTGG - Intergenic
1054316344 9:63591778-63591800 CTTTAGAACTGGCACTTGGCTGG + Intergenic
1054549245 9:66381804-66381826 CTTTAGAACTGGCACTTGGCTGG - Intergenic
1055066836 9:72127393-72127415 CTTTGGAAGGCGGAGGTGGGCGG + Intronic
1055503917 9:76929160-76929182 CTCTAGAAGGTGGAGGTGGGAGG + Intergenic
1055533555 9:77212577-77212599 CTTTGGAAGGCTGAGTTGGGAGG - Intronic
1055533638 9:77213745-77213767 CTTTGGAAGGCTGAGTTGGGAGG - Intronic
1056832354 9:89927510-89927532 TTTGGGAAGGGGAAGTTGGCAGG - Intergenic
1057041167 9:91848515-91848537 CTTTAGGAGGCCGAGTTGGGTGG + Intronic
1057740190 9:97704538-97704560 CTTCAGAAGGAGGATTTGTCTGG - Intergenic
1057900011 9:98941420-98941442 CTTTAGAAGGCTGAGATGGGTGG + Intergenic
1058064498 9:100533958-100533980 CTTTAGAAGGTCGAGGTGGGTGG - Intronic
1058507239 9:105678598-105678620 CTTTAAAAGGGAGAGGGGGCAGG - Intergenic
1058950176 9:109895938-109895960 CTTTAGGAGGTTGAGTTGGGTGG + Intronic
1059297949 9:113289041-113289063 CTTTAGAAGGGGGAGTTGGCTGG - Intronic
1059310305 9:113384265-113384287 CTTTAGGAGGCCGAGGTGGCAGG - Intergenic
1059668260 9:116469959-116469981 CTTTAGGAGGCCGAGGTGGCAGG + Intronic
1059818244 9:117942359-117942381 CTAGAGAAGGTGGAGATGGCAGG + Intergenic
1061023714 9:128033957-128033979 CTTTGGAAGGCGGAGGTGGGAGG - Intergenic
1061305953 9:129733515-129733537 CTTTAGGAGGGTGAGGTGGGCGG - Intergenic
1061383811 9:130276493-130276515 CATTAGCAGGTGGAGTTGACAGG + Intergenic
1061901000 9:133671909-133671931 CTTTGGGAAGGGGAGATGGCAGG + Intronic
1203490604 Un_GL000224v1:101467-101489 CTCTGGAAGTGGGAGTTGTCTGG - Intergenic
1203503227 Un_KI270741v1:43346-43368 CTCTGGAAGTGGGAGTTGTCTGG - Intergenic
1186104072 X:6187230-6187252 CTAAAGAAGGTGGAGTTGGCCGG - Intronic
1186196122 X:7111521-7111543 CTTTAGGTGTGGGAGGTGGCAGG + Intronic
1186944211 X:14547098-14547120 CTTTAGATGGGTGATGTGGCAGG + Intronic
1187235119 X:17459832-17459854 TTTTGGAAGGGGGTGTTGGGAGG - Intronic
1188112354 X:26207420-26207442 CATTGGAAGGCGGAGTTGGGAGG - Intergenic
1189313156 X:40034064-40034086 CTTTAGGAGGCGGAGGTGGACGG + Intergenic
1189515435 X:41709328-41709350 CTTTACAGTGGAGAGTTGGCAGG + Intronic
1189723578 X:43945962-43945984 CTTTTTAAGGGGGATCTGGCTGG + Intergenic
1189725573 X:43965169-43965191 CTTTAGAAGGCAGTGTTGGGAGG + Intronic
1189780780 X:44512326-44512348 CTTTAGGAGGCGGAGGTGGGAGG + Intergenic
1190182113 X:48201509-48201531 CTTTGGAAGGCGGAGATGGGCGG - Intronic
1190195247 X:48312222-48312244 CTTTGGAAGGCGGAGATGGGCGG - Intergenic
1190444665 X:50511951-50511973 CTTGAGAGGGGAGAGTTGGAGGG - Intergenic
1190569994 X:51770935-51770957 CTTTAAAAGGAGGAACTGGCTGG - Intergenic
1193906343 X:87249514-87249536 ATTTAGACGGGGGTGGTGGCGGG - Intergenic
1194674013 X:96771791-96771813 CTTTAGGAGGGTGAGATGGGAGG + Intronic
1195563057 X:106307007-106307029 CATTGGGAGGGTGAGTTGGCAGG - Intergenic
1196530965 X:116785905-116785927 CTTTAGAAGGCTGAGGTGGGTGG + Intergenic
1197419579 X:126222136-126222158 CTTTGGAAGGCTGAGTTGGGCGG - Intergenic
1199147981 X:144394270-144394292 CTTTAGGAGGTGGAGGTGGGTGG + Intergenic
1199918155 X:152367448-152367470 CTTTAGTAGGGTGAATTGGTTGG - Intronic
1200881702 Y:8219888-8219910 TTCTAGAAAGGGGAGGTGGCTGG + Intergenic
1201641086 Y:16177776-16177798 CTTTAGAAGGCTGAGGTGGTAGG + Intergenic
1201661729 Y:16407550-16407572 CTTTAGAAGGCTGAGGTGGTAGG - Intergenic
1202105835 Y:21364033-21364055 TTCTAGAAAGGGGAGATGGCTGG + Intergenic