ID: 1059299671

View in Genome Browser
Species Human (GRCh38)
Location 9:113302285-113302307
Sequence CTGAAACAGCAGTGGATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 550
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 529}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059299671_1059299679 28 Left 1059299671 9:113302285-113302307 CCAGGGATCCACTGCTGTTTCAG 0: 1
1: 0
2: 0
3: 20
4: 529
Right 1059299679 9:113302336-113302358 TATCACCTCCACCCCAAGCCAGG No data
1059299671_1059299677 0 Left 1059299671 9:113302285-113302307 CCAGGGATCCACTGCTGTTTCAG 0: 1
1: 0
2: 0
3: 20
4: 529
Right 1059299677 9:113302308-113302330 GATCAGCTGGGGAGAGATTCTGG 0: 1
1: 0
2: 2
3: 14
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059299671 Original CRISPR CTGAAACAGCAGTGGATCCC TGG (reversed) Intronic
900073465 1:792294-792316 CTGGAAAAGCAGGGCATCCCTGG - Intergenic
900768232 1:4519796-4519818 CAGGATCAGCAGTGGGTCCCAGG - Intergenic
901959670 1:12815322-12815344 CTGAACCAGCCTTGCATCCCAGG + Intergenic
902409124 1:16202488-16202510 CTGAAGCTGCAGGGCATCCCCGG - Exonic
902761476 1:18583641-18583663 CTGAAAGAGCAATGGCTCCCCGG - Intergenic
905410094 1:37762735-37762757 CTGGACCACCAGAGGATCCCTGG + Intronic
906558243 1:46732340-46732362 TTGAAACAGCCTTGCATCCCAGG - Intergenic
907953744 1:59208331-59208353 CTGAACCAGCCTTGTATCCCAGG - Intergenic
908593218 1:65655778-65655800 CTGAACCAGCCTTGCATCCCAGG - Intergenic
909297242 1:73966541-73966563 CTGAACCAGCTTTGAATCCCAGG + Intergenic
909708135 1:78611390-78611412 TTGAACCAGCATTGCATCCCAGG - Intergenic
909826602 1:80134866-80134888 TTGAAACAGCCTTGCATCCCAGG + Intergenic
910346305 1:86242951-86242973 TTGAACCAGCATTGCATCCCAGG - Intergenic
910600863 1:89030854-89030876 TTGAAACAGCCTTGCATCCCAGG + Intergenic
911555309 1:99337732-99337754 TTGAAACAGCCTTGCATCCCAGG + Intergenic
911724660 1:101230386-101230408 CTGAACCAGCCTTGCATCCCAGG - Intergenic
911932713 1:103925164-103925186 CTGAACCAGCCTTGCATCCCAGG - Intergenic
912609283 1:111027114-111027136 CTGAACCAGCCTTGCATCCCAGG - Intergenic
913719560 1:121578083-121578105 CTGAACCAGCCTTGCATCCCAGG - Intergenic
914375266 1:147067729-147067751 TTGAACCAGCATTGCATCCCAGG - Intergenic
915037385 1:152940246-152940268 TTGAAACAGCCTTGCATCCCAGG - Intergenic
915639462 1:157212415-157212437 CTGAACCAGCCTTGCATCCCAGG + Intergenic
916221910 1:162452976-162452998 CTGAATCAGCCTTGCATCCCAGG - Intergenic
916488161 1:165277643-165277665 CTGACAGAGCAGGGGATTCCAGG - Intronic
917174701 1:172220610-172220632 CAGAAACAGCAGTGATTCTCAGG + Intronic
917207563 1:172593594-172593616 TTGAACCAGCCGTGCATCCCAGG + Intronic
917276824 1:173340167-173340189 CTGAAACATCAGTTTTTCCCAGG + Intergenic
917900432 1:179537512-179537534 CTGAACCAGCCTTGCATCCCAGG + Intronic
918475437 1:184919280-184919302 CTGAAGCAGCCTTGGATTCCAGG + Intronic
918548390 1:185711240-185711262 CTGAACCAGCCGTGCATCCCAGG - Intergenic
919395780 1:197045836-197045858 TTGAACCAGCATTGCATCCCAGG - Intronic
919414619 1:197292732-197292754 CTGAACCAGCCTTGTATCCCAGG - Intronic
919603510 1:199651137-199651159 CTGAACCAGCCTTGCATCCCAGG - Intergenic
919919665 1:202160544-202160566 CTGAAGCAGCTGTGGCCCCCAGG + Exonic
920590225 1:207210559-207210581 CTGAATCAGCCTTGCATCCCAGG - Intergenic
921531483 1:216287120-216287142 TTGAACCAGCATTGCATCCCTGG - Intronic
922383519 1:225057848-225057870 TTGAAACAGCCTTGCATCCCAGG + Intronic
922454911 1:225766918-225766940 CTGACACAGAAGTGTAGCCCTGG - Intergenic
924889852 1:248263357-248263379 CTGAATCAGCCTTGGATCACAGG + Intergenic
1064041993 10:11974697-11974719 CTGAACCAGCCTTGCATCCCAGG + Intronic
1064084290 10:12333695-12333717 CAGAAATAGAAGTGGATCTCTGG + Intergenic
1064563538 10:16616688-16616710 CTGAACCAGCCTTGCATCCCAGG - Intronic
1066172098 10:32860235-32860257 CTGAACCAGCCTTGCATCCCAGG - Intronic
1066362026 10:34740300-34740322 CTGAGACAGCAGTGAATTCAAGG + Intronic
1066669317 10:37820312-37820334 CTGAAACAGAAGTGAAGCACAGG + Intronic
1067244388 10:44525135-44525157 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1067474016 10:46554829-46554851 CTGCCACAGCAGAGGAGCCCAGG + Intronic
1067673738 10:48350440-48350462 TTGAAACAGCCTTGCATCCCAGG - Intronic
1068210328 10:53912118-53912140 TTGAACCAGCCTTGGATCCCAGG - Intronic
1068372024 10:56129466-56129488 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1069188661 10:65460628-65460650 TTGAACCAGCCTTGGATCCCAGG + Intergenic
1070519350 10:77238308-77238330 GTGCAACAGCAGTGGGTCTCGGG + Intronic
1071044201 10:81353932-81353954 TTGAAACAGCCTTGTATCCCAGG + Intergenic
1071891538 10:90013254-90013276 TTGAAACAGCCTTGCATCCCAGG - Intergenic
1072394002 10:95019776-95019798 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1073556834 10:104461788-104461810 TTGAAACAGCCTTGCATCCCGGG + Intergenic
1074017626 10:109550112-109550134 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1074869715 10:117567156-117567178 CTGAAATAGCAGTAGTGCCCGGG - Intergenic
1076340037 10:129738976-129738998 TTGAACCAGCCTTGGATCCCAGG - Intronic
1077082456 11:730198-730220 CTTCAAAAGCAGTGGATACCAGG + Intergenic
1077302205 11:1852561-1852583 ATCAAACAGCTGTGGGTCCCAGG - Intergenic
1078351958 11:10602144-10602166 CTGACTCAGCAGTGGTGCCCAGG - Intronic
1078900692 11:15639696-15639718 CTGTAATAGCAGTGGCTCCAAGG - Intergenic
1079660391 11:23030436-23030458 TTGAACCAGCTGTGCATCCCAGG + Intergenic
1079988570 11:27223389-27223411 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1080593266 11:33743002-33743024 CTGAAACAGCTGGGGCTCCTGGG + Intronic
1080906213 11:36547947-36547969 TTGAACCAGCATTGCATCCCAGG - Intronic
1081454607 11:43209027-43209049 TTGAACCAGCTGTGCATCCCAGG + Intergenic
1082174158 11:49042518-49042540 TTGAACCAGCCTTGGATCCCAGG + Intergenic
1082269333 11:50152662-50152684 TTGAAACAGCCTTGCATCCCAGG - Intergenic
1082286796 11:50326422-50326444 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1082316065 11:50723918-50723940 TTGAAACAGCCTTGCATCCCAGG - Intergenic
1082674331 11:56077285-56077307 TTGAAACAGCTGTGCATCCTGGG + Intergenic
1082781779 11:57293698-57293720 ATGGAACAGCAGTGGAGCCCAGG - Intergenic
1083626612 11:64075073-64075095 CTGAAGCCACAGTGGAGCCCAGG - Intronic
1084015079 11:66373812-66373834 CTAAAACTGCAGTGAATCCACGG + Intergenic
1085018149 11:73188692-73188714 GTGAAACCGCAGAGGAGCCCAGG + Intergenic
1085207446 11:74744634-74744656 ATGCAACAGCAGTGGGGCCCTGG - Intergenic
1086117646 11:83269977-83269999 CTGAACCAGCTTTGCATCCCAGG - Intronic
1086438662 11:86806354-86806376 CTGAAACATCAGGTGATGCCTGG + Intronic
1086522738 11:87689071-87689093 CTGAACCAGCTTTGCATCCCAGG - Intergenic
1086691612 11:89793555-89793577 TTGAACCAGCCTTGGATCCCAGG - Intergenic
1086714191 11:90046099-90046121 TTGAACCAGCCTTGGATCCCAGG + Intergenic
1086777524 11:90858180-90858202 TTGAAGCAGCCTTGGATCCCAGG - Intergenic
1087005029 11:93461877-93461899 TTGAACCAGCCGTGCATCCCAGG - Intergenic
1087052413 11:93899341-93899363 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1087083202 11:94191837-94191859 TTGAAACAGCCTTGCATCCCAGG - Intergenic
1087169086 11:95032135-95032157 TTGAAAAGGCAGTGGAGCCCGGG - Intergenic
1087331764 11:96789820-96789842 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1087436063 11:98119135-98119157 TTGAACCAGCCTTGGATCCCAGG + Intergenic
1087466889 11:98519308-98519330 CTGAACCAGCTTTGTATCCCAGG + Intergenic
1089272838 11:117314145-117314167 CAGAAACAGGAGTAGGTCCCAGG + Intronic
1090559536 11:127916531-127916553 TTGAAACAGCCTTGCATCCCAGG - Intergenic
1092939141 12:13391155-13391177 CTGATGCGGCAGTGGAGCCCAGG - Intergenic
1094244745 12:28275793-28275815 TTGAAACAGCCTTGCATCCCAGG - Intronic
1095657143 12:44683739-44683761 TTGAAACAGCCTTGCATCCCAGG + Intronic
1096957588 12:55542447-55542469 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1096990632 12:55799577-55799599 CCGAGACAGCTGTGGCTCCCAGG + Intronic
1098268832 12:68750615-68750637 CTGGAACAGCAGGGGCTCTCAGG - Intronic
1098390991 12:69969701-69969723 TTGGAAAAGCAATGGATCCCAGG + Intergenic
1098529008 12:71519469-71519491 GTGATACAGCAGTGAATACCAGG - Intronic
1098707256 12:73706295-73706317 TTGAAACAGCCTTGTATCCCAGG - Intergenic
1099512124 12:83551429-83551451 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1099642880 12:85314751-85314773 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1099809264 12:87559991-87560013 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1100248791 12:92792954-92792976 TTGAACCAGCATTGCATCCCAGG - Intronic
1100617292 12:96240762-96240784 CTGAAATGGCAGAGGATCCAGGG + Intronic
1100763196 12:97832786-97832808 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1101206252 12:102490810-102490832 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1101263996 12:103065096-103065118 CAAAAACAGTATTGGATCCCTGG + Intergenic
1105201714 13:18185998-18186020 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1105226845 13:18443362-18443384 TTGAACCAGCTTTGGATCCCAGG - Intergenic
1105317560 13:19280558-19280580 TTGAAACAGCCTTGCATCCCAGG - Intergenic
1105649706 13:22362436-22362458 TTGAATCAGCACTGCATCCCAGG - Intergenic
1105672332 13:22633374-22633396 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1105832267 13:24173779-24173801 CTGAATCAGTCTTGGATCCCTGG + Intronic
1106224062 13:27771858-27771880 TGGAAACCTCAGTGGATCCCAGG + Intergenic
1106445418 13:29826015-29826037 CTGAACCAGCCTTGCATCCCAGG + Intronic
1107439926 13:40417059-40417081 TTGAAACAGCCTTGAATCCCAGG - Intergenic
1107694362 13:42986063-42986085 CTGCAACAGCACTGGCACCCTGG + Intronic
1108754312 13:53481459-53481481 CAGAAACAGCAGTGTGTCCAAGG - Intergenic
1109013908 13:56983455-56983477 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1109675592 13:65672127-65672149 TTGAACCAGCATTGCATCCCAGG + Intergenic
1110159232 13:72355510-72355532 CTGAAACAGACGTGGGTGCCAGG + Intergenic
1110351405 13:74512690-74512712 CAGAAAGAGCAGTGGATAACAGG - Intergenic
1110878468 13:80540250-80540272 CTGAAACAGCCTTGCATCCCAGG + Intergenic
1110942408 13:81366654-81366676 TTGAAACAGCCTTGCATCCCAGG - Intergenic
1112087711 13:96049153-96049175 TTGAAACAGCCTTGCATCCCAGG - Intronic
1112422040 13:99261161-99261183 CAGTAACAACAGTGGACCCCTGG - Intronic
1113234342 13:108253452-108253474 CTGAACCAACATTGCATCCCAGG + Intronic
1114141284 14:19913815-19913837 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1114358265 14:21939415-21939437 TTGAAACAACTTTGGATCCCAGG + Intergenic
1114433323 14:22681619-22681641 TTGAACCAGCATTGCATCCCAGG - Intergenic
1114765581 14:25367090-25367112 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1114904849 14:27114655-27114677 CTGAACCAGCCCTGCATCCCAGG + Intergenic
1116165240 14:41326681-41326703 TTGAACCAGCCTTGGATCCCAGG + Intergenic
1116166210 14:41337344-41337366 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1116339407 14:43702325-43702347 TTGAACCAGCCTTGGATCCCAGG - Intergenic
1116511474 14:45752343-45752365 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1116533358 14:46000499-46000521 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1117418547 14:55520759-55520781 CTGAAACATCTTTGCATCCCTGG - Intergenic
1118515732 14:66526794-66526816 TTGAACCAGCATTGCATCCCAGG + Intronic
1120114034 14:80592822-80592844 CTGAACCAGCCTTGCATCCCAGG - Intronic
1120244282 14:81987991-81988013 CTGAAGCAGCAGTGGAGACCAGG - Intergenic
1120695204 14:87637096-87637118 CTGAAACAGCAGTGTAGCTGGGG + Intergenic
1120709415 14:87777778-87777800 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1123216149 14:106810930-106810952 CAGAAACAGCTGGGAATCCCAGG + Intergenic
1123452131 15:20374777-20374799 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1123569610 15:21590678-21590700 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1123572709 15:21630658-21630680 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1123605720 15:22025997-22026019 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1123609331 15:22073245-22073267 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1124894326 15:33761930-33761952 TTGAACCAGCCTTGGATCCCAGG - Intronic
1125054024 15:35336765-35336787 TTGAAACAGCCTTGCATCCCAGG + Intronic
1128603001 15:69013686-69013708 CTGAACCAGCAGGGGCTCACTGG - Intronic
1128927603 15:71672807-71672829 TTGAACCAGCCTTGGATCCCAGG + Intronic
1129231436 15:74199221-74199243 CTGACCCAGCAGAGCATCCCAGG - Intronic
1130382965 15:83387272-83387294 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1130922601 15:88360879-88360901 TTGAACCAGCCTTGGATCCCAGG - Intergenic
1131903073 15:97110182-97110204 TTGAACCAGCATTGCATCCCAGG - Intergenic
1202977961 15_KI270727v1_random:317769-317791 CTGAAGCAGCCTTGCATCCCAGG + Intergenic
1202981570 15_KI270727v1_random:365030-365052 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1133183890 16:4081334-4081356 CAGAACCAGCAGTGGCTCCATGG + Intronic
1135004482 16:18806775-18806797 GAGAAACAGGAGAGGATCCCTGG + Exonic
1135301430 16:21331342-21331364 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1136567896 16:31080903-31080925 CTGCAAGAGGAGTGGCTCCCTGG - Exonic
1136681441 16:31966819-31966841 TTGAAACAGCCTTGCATCCCAGG - Intergenic
1136781751 16:32908330-32908352 TTGAAACAGCCTTGCATCCCAGG - Intergenic
1136888042 16:33945523-33945545 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1137396955 16:48122982-48123004 CAGAAACAGCTGGGGAACCCAGG + Intronic
1137450137 16:48565464-48565486 CTGAACCAGCCTTGCATCCCTGG + Intronic
1138357550 16:56395351-56395373 TTGAACCAGCATTGCATCCCAGG - Intronic
1138423754 16:56916696-56916718 CTGACTGGGCAGTGGATCCCAGG - Intergenic
1138837469 16:60456308-60456330 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1140281264 16:73557133-73557155 CTGAGACAGCTGAGGACCCCAGG + Intergenic
1141433129 16:83981156-83981178 CTGAAGCAGCACTGGAGCCCTGG - Intronic
1203084407 16_KI270728v1_random:1172315-1172337 TTGAAACAGCCTTGCATCCCAGG - Intergenic
1142991908 17:3736995-3737017 AGGAAACAGTAGTGGATGCCTGG + Intronic
1143332929 17:6151005-6151027 CTGCACTAGCAATGGATCCCAGG - Intergenic
1145715106 17:27011965-27011987 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1146131757 17:30283067-30283089 CTGAAGCAGCATTTGAGCCCAGG + Intronic
1146145156 17:30409176-30409198 TTGAAACAGCCTTGCATCCCAGG + Intronic
1147754537 17:42760040-42760062 CTGAAGCAGCTGAGGAGCCCAGG - Intronic
1148222564 17:45873871-45873893 CTGACACAGCAGAGAAACCCTGG - Intergenic
1148764137 17:50027641-50027663 CTGGAACAGGACTGGGTCCCGGG + Intergenic
1148950665 17:51308763-51308785 TTGAACCAGCATTGCATCCCAGG - Intergenic
1150196085 17:63301097-63301119 CTGAACCAGCCTTGCATCCCAGG + Intronic
1150457007 17:65314229-65314251 CTGACACAGCAGAGGGTCTCTGG + Intergenic
1150638536 17:66933681-66933703 TTGAAACAGCTGTGGGTCTCAGG + Intergenic
1151010351 17:70486348-70486370 CTGAAACAGCATTAGTTCCAAGG + Intergenic
1151962873 17:77416471-77416493 CTGAAGCAGCAGTGAAGCCAGGG + Intronic
1152201259 17:78947782-78947804 CTGGGAAAGCAGTGGCTCCCTGG + Intergenic
1152285939 17:79413466-79413488 CACAAACAGCAGGGAATCCCTGG + Intronic
1153058316 18:969828-969850 TTGAACCAGCATTGCATCCCAGG + Intergenic
1153665455 18:7364162-7364184 CTGAAACAGCAGGGGGTCTGGGG + Intergenic
1153757092 18:8295106-8295128 CAGAAACAACAGAGGATGCCAGG + Intronic
1153865880 18:9268443-9268465 CTGAACCAGCCTTGCATCCCAGG - Intronic
1154526536 18:15296112-15296134 TTGAACCAGCCTTGGATCCCAGG + Intergenic
1155681223 18:28489311-28489333 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1156229781 18:35142297-35142319 CTGATACTGCAGTGGTTCCTAGG + Exonic
1156981149 18:43289737-43289759 TTGAACCAGCATTGCATCCCAGG - Intergenic
1157217402 18:45796383-45796405 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1159231761 18:65617179-65617201 TTGAAACAACATTGCATCCCAGG + Intergenic
1159632624 18:70766481-70766503 TTGAAACAGCCTTGCATCCCAGG - Intergenic
1160297010 18:77648010-77648032 CTCAAACAGCTGAGGGTCCCTGG - Intergenic
1164243941 19:23414613-23414635 CTTACACAGCAGTGGATGGCAGG - Intergenic
1164361506 19:27517373-27517395 TTGAACCAGCCGTGCATCCCAGG + Intergenic
1164888020 19:31799786-31799808 CTGAAGAAACAGTGGAGCCCAGG + Intergenic
1166263549 19:41660918-41660940 TTGAAACAGCCTTGCATCCCAGG - Intronic
1166900313 19:46056513-46056535 CTAAAACTCCAGGGGATCCCTGG - Intronic
1167487975 19:49774269-49774291 CTGAAGCAGCCGTACATCCCTGG + Intronic
925322106 2:2980285-2980307 TTGAAACATCTTTGGATCCCTGG - Intergenic
927020970 2:19016865-19016887 CTGAACCAGCCTTGCATCCCAGG + Intergenic
927695188 2:25235108-25235130 CTGTCACTGCAGTGGTTCCCTGG + Intronic
928812012 2:35239251-35239273 CTGAAGCAGCTTTGCATCCCAGG - Intergenic
929130968 2:38570743-38570765 CTGAAACTGCAGACAATCCCTGG + Intronic
929232838 2:39577335-39577357 CTGAACCAGCCTTGCATCCCAGG + Intergenic
933568557 2:83980204-83980226 TTGAAACAGCCTTGCATCCCAGG - Intergenic
933631652 2:84665923-84665945 CTGAACCAGCCGTGCATCCCAGG - Intronic
934472947 2:94572526-94572548 CTGAACCAGCCTTGCATCCCAGG + Intergenic
935231323 2:101099683-101099705 TTGAACCAGCCTTGGATCCCAGG - Intronic
936273303 2:111068956-111068978 CTGAAATACAAGTGGATCACTGG + Intronic
936463949 2:112730576-112730598 CTGAGACAGGAGTGGATGCCTGG + Intronic
936798318 2:116234605-116234627 CTGAACCAGCCTTGCATCCCAGG - Intergenic
936995853 2:118413391-118413413 TTGAACCAGCATTGCATCCCAGG - Intergenic
937147574 2:119660535-119660557 CAGAAACAGCTGTTGAACCCAGG - Intronic
937165228 2:119807897-119807919 CTGAACCAGCCTTGCATCCCAGG - Intronic
937298486 2:120824142-120824164 CTAAAGCACCAGTGGAACCCAGG + Intronic
937807642 2:126164593-126164615 TTGAAACAGCCTTGCATCCCAGG - Intergenic
937810430 2:126193824-126193846 CTGAAACAGAAGTTGATCACTGG + Intergenic
938243479 2:129760622-129760644 AAAAAACAGCAGTGGTTCCCCGG + Intergenic
938525630 2:132127478-132127500 TTGAACCAGCCTTGGATCCCAGG + Intergenic
938567513 2:132532667-132532689 TTGAAACAGCCTTGCATCCCAGG - Intronic
939711227 2:145522348-145522370 CTGAACCAGCCTTGCATCCCAGG - Intergenic
939840963 2:147186204-147186226 CTGAACCAGCCTTGCATCCCAGG - Intergenic
941001770 2:160209518-160209540 CTGAAACAGCTGGAGAACCCTGG - Intronic
941763305 2:169268429-169268451 CTGAACCAGCATTGCATCACAGG - Intronic
942010469 2:171757537-171757559 CTGAACCAGCCTTGCATCCCAGG + Intergenic
942107940 2:172652140-172652162 CTGAACCAGCCTTGCATCCCAGG - Intergenic
942200268 2:173563736-173563758 TTGAAACAGCCTTGCATCCCAGG - Intergenic
942568239 2:177287998-177288020 CTGAAACCTCAGTGCAGCCCTGG + Intronic
942807471 2:179949169-179949191 CTGAATCAGCAGATGCTCCCAGG - Intronic
942952378 2:181735488-181735510 TTGAAACAGCCTTGCATCCCAGG - Intergenic
943140819 2:183979237-183979259 TTGAACCAGCCTTGGATCCCAGG - Intergenic
944197129 2:197066111-197066133 CTGAACCAGCCTTGCATCCCAGG - Intronic
944249248 2:197564804-197564826 CTGAACCAGCCTTGCATCCCAGG + Intergenic
944909825 2:204299560-204299582 CTGAGCCAGCAATGGAACCCAGG - Intergenic
945414784 2:209557628-209557650 CTGAAATGGCCCTGGATCCCAGG + Intronic
945485785 2:210394376-210394398 CTGAAACAGAAATGGATTCATGG - Intergenic
947344946 2:229180896-229180918 GTGAAACAGCAGTTGAACACGGG - Intronic
947378776 2:229524711-229524733 CTGAAACAGCTGTGGACACCAGG + Intronic
948781459 2:240324230-240324252 CTCAAACAGCAGTGGGGCCCGGG + Intergenic
1170789888 20:19498992-19499014 CTGGAACAGCTGGGGCTCCCTGG - Intronic
1171733500 20:28740151-28740173 TTGAAACAGCCTTGCATCCCAGG - Intergenic
1171859691 20:30385539-30385561 GTGAAAAAGCCGTGGATCCTAGG - Intronic
1174619856 20:51865670-51865692 CTGAAACAGCTGGGGGACCCTGG - Intergenic
1174925503 20:54754950-54754972 TTGAAACAGCTTTGCATCCCAGG - Intergenic
1175981143 20:62739309-62739331 CTGGAACAGCAGTGGGACCCAGG - Intronic
1176194111 20:63829244-63829266 CCGAAACAGGAGTGGAACTCAGG + Intronic
1176716236 21:10351989-10352011 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1176770897 21:13072382-13072404 TTGAACCAGCCTTGGATCCCAGG - Intergenic
1177373453 21:20237238-20237260 TTGAACCAGCCGTGTATCCCAGG + Intergenic
1177573531 21:22921521-22921543 TTGAAACAGCCTTGCATCCCAGG - Intergenic
1177591076 21:23168673-23168695 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178497439 21:33099246-33099268 CTGAAACAGCAGAAGGGCCCAGG + Intergenic
1179301293 21:40113234-40113256 CTGAACCAGCCTTGCATCCCAGG - Intronic
1179410903 21:41162468-41162490 CAGAATCAGAAGTTGATCCCAGG + Intergenic
1179902130 21:44399791-44399813 CTGGAGCAGCAGGGGCTCCCAGG + Intronic
1180602099 22:17027947-17027969 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1180881686 22:19208606-19208628 TTGAAACACCAGAAGATCCCTGG + Intronic
1182176842 22:28298858-28298880 CCGAAGCAGCAGTGGATACTGGG - Intronic
1182179882 22:28336158-28336180 CTGAACCAGCCTTGCATCCCAGG + Intronic
1182900889 22:33897374-33897396 CTGAAATAATAATGGATCCCTGG - Intronic
1184755121 22:46511582-46511604 CTCAGAGAGCTGTGGATCCCAGG + Intronic
1184932379 22:47690828-47690850 CTTACACAGAAGTGGTTCCCAGG - Intergenic
949155355 3:820306-820328 CTGAACCAGCCTTGCATCCCAGG - Intergenic
949209539 3:1481286-1481308 CTGAACCAGCCTTGCATCCCAGG - Intergenic
949222695 3:1654954-1654976 TTGAACCAGCATTGCATCCCAGG + Intergenic
949421074 3:3866549-3866571 CTGAACCAGCCTTGCATCCCAGG - Intronic
950364092 3:12470976-12470998 CTGAAAGAGCAATGAATGCCAGG + Intergenic
950995443 3:17491625-17491647 CTGAACCAGCCTTGCATCCCGGG + Intronic
953174026 3:40532880-40532902 CTGAAGCAGAACAGGATCCCTGG - Exonic
954114669 3:48459810-48459832 CTGAAGCAGCCTTTGATCCCAGG + Exonic
954135380 3:48579898-48579920 CTGAAACCTCCGCGGATCCCTGG - Intronic
954294447 3:49666313-49666335 CTGGAAAAGCAGTGGGGCCCTGG + Intronic
956308633 3:67854246-67854268 TTGAATCAGCATTGGCTCCCAGG + Intergenic
956399185 3:68858753-68858775 CAGAACCAGCACTTGATCCCTGG + Intronic
956661330 3:71601310-71601332 CTGAACCAGGATTAGATCCCAGG - Intergenic
956965329 3:74452835-74452857 CTGAACCAGCCTTGCATCCCAGG + Intronic
957033903 3:75275774-75275796 CTGAACCAGCCTTGCATCCCAGG + Intergenic
957474140 3:80702504-80702526 CTGAAACATCCTTGAATCCCTGG + Intergenic
957538602 3:81538879-81538901 CTGGGACAGCCGTGGATCTCTGG + Intronic
958105811 3:89071007-89071029 ATGAACCAGCATTGCATCCCAGG - Intergenic
958726008 3:97907065-97907087 TTGAAACAGCCTTGCATCCCAGG + Intronic
959255896 3:104013102-104013124 TTGAAACAGCCTTGCATCCCAGG - Intergenic
959838642 3:110949371-110949393 CTGTAACAGCAGGGGGGCCCTGG + Intergenic
959845003 3:111022404-111022426 TTGAACCAGCATTGCATCCCAGG - Intergenic
960075790 3:113483696-113483718 CTGAACCAGCCTTGCATCCCAGG + Intronic
960621523 3:119641503-119641525 CTGAAACAGCTGGGAATCCTTGG - Intronic
960647215 3:119899551-119899573 CAAAAAGATCAGTGGATCCCTGG - Intronic
960784084 3:121353001-121353023 TTGAACCAGCATTGCATCCCAGG + Intronic
961304801 3:125951071-125951093 CTCAAACAGAAGTGCAGCCCTGG - Intergenic
961395764 3:126588297-126588319 TTGAACCAGCCTTGGATCCCAGG + Intronic
962183586 3:133234422-133234444 TTGAAACAGCCTTGCATCCCAGG - Intronic
962907717 3:139820239-139820261 TTGAAACAGCCTTGCATCCCAGG - Intergenic
963481143 3:145876355-145876377 CTGAACCAGCCTTGCATCCCAGG + Intergenic
963778564 3:149464451-149464473 CTGAAACAGCAGTCAATCATTGG + Intergenic
964053505 3:152423754-152423776 CTGAACCAGCCTTGCATCCCAGG - Intronic
964100610 3:152984042-152984064 TTGAACCAGCCGTGCATCCCAGG - Intergenic
965217385 3:165880746-165880768 CTGAACCAGCCTTGCATCCCAGG - Intergenic
965318106 3:167215801-167215823 TTGAAACAACATTGCATCCCAGG - Intergenic
965673203 3:171168358-171168380 GAGATACAGGAGTGGATCCCAGG + Intronic
966027290 3:175300106-175300128 CTGAACCAGCCTTGCATCCCTGG + Intronic
966477901 3:180371183-180371205 TTGAAACAGCCTTGCATCCCAGG - Intergenic
966536691 3:181043070-181043092 TTGAATCAGCCTTGGATCCCAGG + Intergenic
968388510 4:168169-168191 TTGAAACAGCCTTGCATCCCAGG + Intergenic
968980859 4:3848691-3848713 CTGAAATTGGAGTGGATGCCAGG + Intergenic
969648862 4:8451155-8451177 CTGAAGCACCTGTGGGTCCCCGG + Intronic
970298180 4:14653849-14653871 CTGACACAGCAGAGTATCCCTGG - Intergenic
970600415 4:17637320-17637342 CTGAAAAAGCAGTGGGGGCCGGG - Intronic
972068105 4:34978373-34978395 CTGAAACAGCCTTGCATACCTGG + Intergenic
972417042 4:38851052-38851074 TTGAAACAGCCTTGCATCCCAGG - Intronic
973149353 4:46867695-46867717 CTGAACCAACATTGCATCCCAGG + Intronic
974316419 4:60287685-60287707 CTGAACCAGCCTTGCATCCCAGG + Intergenic
975150503 4:71015605-71015627 CTGAACCAGCCTTGCATCCCAGG - Intronic
975284158 4:72597521-72597543 CTGAACCAGCCTTGCATCCCAGG - Intergenic
976093135 4:81477759-81477781 CTGAACCAGCCTTGCATCCCAGG - Intronic
976533970 4:86190066-86190088 CTGAAACACCCTTGCATCCCAGG + Intronic
976975536 4:91162250-91162272 TTGAAACAGCCTTGCATCCCAGG + Intronic
977056695 4:92201724-92201746 CTGAACCAGCCTTGCATCCCAGG + Intergenic
977086245 4:92602375-92602397 TTGAAACAGCTTTGCATCCCAGG - Intronic
977490208 4:97701085-97701107 CAGAAACAGTATTGCATCCCTGG - Intronic
978185658 4:105854415-105854437 TTGAACCAGCCGTGCATCCCAGG + Intronic
978565824 4:110080413-110080435 CTGAACCAGCCTTGCATCCCAGG - Intronic
978940099 4:114426060-114426082 TTGAAACAGCCTTGCATCCCAGG + Intergenic
979048598 4:115901320-115901342 TTGAAACAGCCTTGCATCCCAGG - Intergenic
979421740 4:120512932-120512954 CTGAACCAGCCTTGCATCCCAGG - Intergenic
979628181 4:122870152-122870174 TTGAAACAGCCTTGCATCCCAGG + Intronic
979659901 4:123241454-123241476 TTGAAACAGCCTTGCATCCCAGG - Intronic
979742734 4:124171305-124171327 TTGAACCAGCATTGCATCCCTGG - Intergenic
979953080 4:126919668-126919690 TTGAAACAGCCTTGCATCCCAGG - Intergenic
980099966 4:128532202-128532224 CTGAACCAGCCTTGCATCCCAGG + Intergenic
980317289 4:131218752-131218774 TTGAAACAGCTTTGCATCCCAGG + Intergenic
980326740 4:131356074-131356096 CTGAACCAGCCTTGCATCCCAGG - Intergenic
982528584 4:156509404-156509426 TTGAAACAGCCTTGTATCCCAGG - Intergenic
982848599 4:160281398-160281420 CTGAACCAGCCTTGCATCCCAGG - Intergenic
982888894 4:160821889-160821911 TTGAAACAGCCTTGCATCCCAGG - Intergenic
983048840 4:163020092-163020114 TTGAACCAGCCGTGCATCCCAGG + Intergenic
983334294 4:166372803-166372825 TTGAACCAGCCTTGGATCCCAGG + Intergenic
983464985 4:168075833-168075855 TGGAAACAGCCTTGGATCCCTGG - Intergenic
985350447 4:189055767-189055789 CTGAACCAGCAGAAGAGCCCAGG - Intergenic
988586216 5:32509899-32509921 GTGGACCAGCAGTGGATCCATGG - Intergenic
989490323 5:42044622-42044644 TTGAAACAGCCTTGGATACCTGG - Intergenic
993082397 5:83318026-83318048 CTGAACCAGCCTTGCATCCCAGG - Intronic
993757298 5:91747533-91747555 TTGAAACAGCCTTGGATCCCAGG + Intergenic
993779401 5:92047508-92047530 TTGAACCAACATTGGATCCCAGG + Intergenic
994779915 5:104076680-104076702 CTGAACCAGCCTTGCATCCCAGG + Intergenic
994850678 5:105051548-105051570 CTGAACCAGCCTTGCATCCCAGG + Intergenic
995262904 5:110126232-110126254 TTGAACCAGCATTGCATCCCAGG + Intergenic
995268124 5:110188499-110188521 TTGAAACAGCCTTGCATCCCAGG - Intergenic
995467201 5:112463059-112463081 TTGAAACAGCCTTGCATCCCAGG + Intergenic
996170491 5:120284184-120284206 CTGAACCAGCCTTGCATCCCAGG - Intergenic
996910515 5:128652284-128652306 TTGAAACAGCCTTGCATCCCAGG + Intronic
997027823 5:130087039-130087061 TTGAAACAGCCTTGCATCCCAGG - Intronic
997245570 5:132345777-132345799 TTGAAACAGCCTTGCATCCCAGG + Intergenic
997339886 5:133135434-133135456 CTGAACCAGCCTTGCATCCCAGG + Intergenic
997790317 5:136753649-136753671 TTGAAACAGCCTTGCATCCCAGG + Intergenic
998247287 5:140518610-140518632 CTGAACCAGCCTTGCATCCCAGG - Intronic
998497213 5:142601344-142601366 CTGAGACAGAAGAGGTTCCCAGG + Intronic
999173665 5:149616626-149616648 CTGCAGCAGCAGTGGGTACCTGG - Exonic
1000246231 5:159450683-159450705 CTAGAACAGCAGAGGATCCTTGG - Intergenic
1000421012 5:161037723-161037745 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1001789633 5:174444897-174444919 CTGGAAGAGCAGTGGCTCCTGGG + Intergenic
1002216237 5:177635880-177635902 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1002233773 5:177788499-177788521 TTGAAACAGCCTTGCATCCCAGG + Intronic
1002551958 5:180001315-180001337 CTGCAGCAGCACTGGATTCCAGG + Intronic
1003017329 6:2478605-2478627 CTGACTCAGCAGTGGATACCTGG + Intergenic
1003438397 6:6116507-6116529 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1003827408 6:9968354-9968376 CTGAACCAGCCTTGCATCCCAGG + Intronic
1005637630 6:27766731-27766753 CTGAAACAGGTGTGGAACCAAGG + Intergenic
1006091704 6:31632298-31632320 TTGAAAGAGAAGTTGATCCCAGG + Exonic
1006874463 6:37283259-37283281 CTGAAACAGGAGTGAAGCACAGG - Intronic
1007205499 6:40146760-40146782 CTGTAACAGCAGTCCATCTCTGG - Intergenic
1007551141 6:42730470-42730492 CTGAAAAAGAAGCAGATCCCTGG - Intergenic
1007928487 6:45669111-45669133 CTGAAGCACCAGTGGCTCCTAGG + Intergenic
1008619868 6:53261174-53261196 CTGAGCCAGCAGTGAATCCCTGG + Intergenic
1009237303 6:61138487-61138509 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1009307318 6:62106764-62106786 CTGAACCAGCCTTGCATCCCAGG - Intronic
1009393579 6:63170783-63170805 TTGAACCAGCATTGCATCCCAGG - Intergenic
1009613361 6:65974806-65974828 TTGAACCAGCCTTGGATCCCAGG - Intergenic
1009647485 6:66425298-66425320 TTGAAACAGCCTTGCATCCCAGG - Intergenic
1009822048 6:68814808-68814830 TTGAAACAGCCTTGCATCCCAGG - Intronic
1010286241 6:74081360-74081382 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1010307305 6:74340103-74340125 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1010670439 6:78680122-78680144 TTGAACCAGCCTTGGATCCCAGG - Intergenic
1011076037 6:83440094-83440116 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1011189525 6:84715174-84715196 CTGAAACAGAAGTGGCTTTCAGG - Intronic
1011235842 6:85215620-85215642 CTGAAGCAGCTTTGCATCCCAGG - Intergenic
1012285086 6:97378850-97378872 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1012516905 6:100072273-100072295 TTGAACCAGCATTGCATCCCAGG - Intergenic
1012596763 6:101050483-101050505 CTGAACCAGCCTTGAATCCCAGG + Intergenic
1013625306 6:111931309-111931331 TTGAAGCAGCATTGCATCCCAGG + Intergenic
1014157404 6:118127300-118127322 TTGAAACAGCCTTGCATCCCAGG + Intronic
1014347693 6:120294863-120294885 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1014547543 6:122750668-122750690 CTTTAACAGCAGTGGGGCCCAGG - Intergenic
1014811625 6:125893199-125893221 CTGAAACTCCAGTGGATGCATGG - Intronic
1015418874 6:132983399-132983421 TTGAACCAGCCTTGGATCCCAGG + Intergenic
1015559148 6:134496206-134496228 GTGAAACAGCAGTGGAGGGCCGG + Intergenic
1015590622 6:134819379-134819401 CACAAAAAGCAGTTGATCCCTGG - Intergenic
1016111824 6:140233915-140233937 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1017477783 6:154815451-154815473 CTGAACCATCTGTGGATGCCAGG - Intronic
1018198603 6:161376121-161376143 CTGAAGCAGCAGTGGCTCCAGGG - Intronic
1019177595 6:170168094-170168116 CTGGAACAGGAGTGGCTGCCAGG + Intergenic
1020996696 7:15274437-15274459 TTGAACCAGCCGTGCATCCCAGG + Intronic
1021060123 7:16100971-16100993 TTGAAACAGCCTTGCATCCCAGG + Intronic
1021347319 7:19544582-19544604 CTGAATCAGCCTTGCATCCCAGG + Intergenic
1021948057 7:25747518-25747540 TTGAACCAGCCTTGGATCCCAGG - Intergenic
1021967531 7:25935752-25935774 TTGAAACAGCCTTGCATCCCAGG - Intergenic
1022361877 7:29668409-29668431 TTGAAACAGCCTTGCATCCCTGG + Intergenic
1022699515 7:32745326-32745348 TTGAAACAGCCTTGCATCCCTGG - Intergenic
1023084344 7:36555304-36555326 CTGAACCAGCCTTGCATCCCAGG + Intronic
1023458228 7:40365084-40365106 CTGAACCAGCCTTGCATCCCAGG - Intronic
1023510744 7:40950776-40950798 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1024015848 7:45313923-45313945 CTGAATTAGCATTGTATCCCTGG + Intergenic
1024591610 7:50890676-50890698 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1025183798 7:56840727-56840749 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1025214025 7:57040216-57040238 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1025547498 7:62195737-62195759 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1025657928 7:63536601-63536623 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1027568252 7:79827324-79827346 CTGAAACATCAGGAGATACCTGG + Intergenic
1027602137 7:80252374-80252396 TTGAAACAGCCTTGCATCCCAGG - Intergenic
1028476097 7:91255045-91255067 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1029855211 7:103508333-103508355 CTGAACCAGCCTTGTATCCCAGG - Intronic
1030539704 7:110815285-110815307 CTGAACCAGCCTTGCATCCCAGG + Intronic
1030622452 7:111805056-111805078 GTGAGACAGCAGTAGATCCTGGG - Intronic
1030791827 7:113739725-113739747 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1031699377 7:124904317-124904339 TTGAACCAGCCTTGGATCCCAGG - Intronic
1032295548 7:130635029-130635051 CTGAACCAGCCTTGCATCCCAGG + Intronic
1032922949 7:136569965-136569987 ATGAAAGATCAGTGGAGCCCAGG - Intergenic
1033719088 7:144037881-144037903 CTGAGACAGCAGGAGCTCCCGGG + Intergenic
1033787586 7:144752447-144752469 CTGAACCAGCCTTAGATCCCAGG + Intronic
1034372254 7:150609408-150609430 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1034830369 7:154303401-154303423 CTTACACCGCAGTGGCTCCCAGG + Intronic
1035542190 8:449294-449316 CTGGAAAAGCAGGGCATCCCTGG + Intronic
1035790920 8:2304283-2304305 TTGAACCAGCATTGCATCCCAGG + Intergenic
1035801885 8:2417422-2417444 TTGAACCAGCATTGCATCCCAGG - Intergenic
1036823406 8:11957470-11957492 CAGAAACCGCACTGGATCCCAGG - Intergenic
1037213303 8:16418584-16418606 CTGAACCAGCCTTGCATCCCAGG - Intronic
1037792036 8:21953293-21953315 CAGAAAGAGCAGTGGTTGCCAGG - Intronic
1039103318 8:33964050-33964072 TTGAACCAGCCTTGGATCCCAGG + Intergenic
1039127414 8:34218740-34218762 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1039265554 8:35819807-35819829 TTGAAACAGCCTTGCATCCCAGG - Intergenic
1040094154 8:43427530-43427552 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1040686341 8:49877437-49877459 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1041021033 8:53638978-53639000 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1041204124 8:55480223-55480245 TTGAAACAGCCTTGCATCCCAGG - Intronic
1041478247 8:58289282-58289304 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1041852046 8:62403461-62403483 GTTAAACAGCAGGGGAGCCCTGG - Intronic
1041900279 8:62974980-62975002 TTGAAACAGCCTTGCATCCCAGG + Intronic
1042959642 8:74289889-74289911 CTGAACCAGCCTTGCATCCCAGG + Intronic
1043235999 8:77867687-77867709 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1043323044 8:79014605-79014627 CTGAAACACCAGTGGGTCAATGG - Intergenic
1045728276 8:105201698-105201720 TTGAAACAGCCTTGCATCCCAGG - Intronic
1046894495 8:119458517-119458539 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1046896202 8:119476188-119476210 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1047552308 8:125888059-125888081 TTGAAACAGAATTGGAACCCAGG - Intergenic
1047700999 8:127449310-127449332 CTGAAAGAGCAGTGATTTCCAGG - Intergenic
1048207614 8:132427789-132427811 CTGAAACAGCAGCTGAGCACAGG + Intronic
1048982507 8:139710416-139710438 TTGGAACAGCAGGGTATCCCTGG - Intergenic
1049174561 8:141183859-141183881 TTGAAACAGGAGTGGAGTCCAGG + Intronic
1051045400 9:12867135-12867157 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1051260707 9:15261580-15261602 TTGAAACACCAGTGGGGCCCTGG - Intronic
1051299372 9:15631842-15631864 TTGAAACAGCCTTGCATCCCAGG - Intronic
1052146791 9:25060457-25060479 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1052335988 9:27320632-27320654 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1052547011 9:29892426-29892448 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1052761534 9:32597132-32597154 GTGAGACAGCAGTGGATCTAGGG + Intergenic
1053679293 9:40470769-40470791 TTGAAACAGCCTTGTATCCCGGG - Intergenic
1053929283 9:43099114-43099136 TTGAAACAGCCTTGTATCCCGGG - Intergenic
1054284425 9:63154174-63154196 TTGAAACAGCCTTGTATCCCGGG + Intergenic
1054292373 9:63306307-63306329 TTGAAACAGCCTTGTATCCCGGG - Intergenic
1054390393 9:64610780-64610802 TTGAAACAGCCTTGTATCCCGGG - Intergenic
1054505326 9:65905526-65905548 TTGAAACAGCCTTGTATCCCGGG + Intergenic
1054886928 9:70208950-70208972 CTGAACCAGCCTTGCATCCCAGG + Intronic
1055276212 9:74619860-74619882 CTGAACCAGCCTTGCATCCCAGG + Intronic
1055390599 9:75818069-75818091 TTGAACCAGCCTTGGATCCCAGG + Intergenic
1055402020 9:75934135-75934157 CTGAAATAGGAGTGCATTCCAGG - Intronic
1055556618 9:77480370-77480392 CTGAACCAGCCTTGCATCCCAGG + Intronic
1056754295 9:89372503-89372525 CTTAGACAGCAGTCCATCCCAGG + Intronic
1057886323 9:98832683-98832705 CTGAAAGAACAGAGGTTCCCAGG - Intronic
1058081611 9:100706801-100706823 TTGAACCAGCCTTGGATCCCAGG + Intergenic
1058134767 9:101294624-101294646 CTGAACCAGCCTTGCATCCCAGG - Intronic
1059261322 9:112979567-112979589 TTGAAACAGCCTTGCATCCCAGG - Intergenic
1059299671 9:113302285-113302307 CTGAAACAGCAGTGGATCCCTGG - Intronic
1060518724 9:124281956-124281978 CAGACACAGAAGTGGAGCCCGGG + Intronic
1061928303 9:133818535-133818557 CTGACACATCACTGGCTCCCTGG + Intronic
1186929483 X:14372903-14372925 TTGAACCAGCATTGCATCCCAGG - Intergenic
1188792289 X:34418829-34418851 TTGAACCAGCATTGCATCCCAGG - Intergenic
1189236819 X:39493472-39493494 CTGAAATAGCAATGGCTACCTGG - Intergenic
1189590982 X:42510843-42510865 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1189953582 X:46256669-46256691 CTGAAACTGCAGTGGGATCCAGG + Intergenic
1190403585 X:50063831-50063853 CTGAACCAGCCTTGCATCCCAGG - Intronic
1190467277 X:50738000-50738022 CTGAACCAGCCTTGCATCCCAGG - Intronic
1190603339 X:52114936-52114958 TTGAAACAGCCTTGCATCCCCGG - Intergenic
1190901692 X:54680718-54680740 CTGAACCAGCATTGCATCCAAGG - Intergenic
1190973605 X:55377726-55377748 TTGAATCAGCCGTGCATCCCAGG + Intergenic
1191049862 X:56179810-56179832 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1191173886 X:57479791-57479813 CTGAACCAGCCTTGCATCCCAGG + Intronic
1191209177 X:57866965-57866987 TTGAAACAGCCTTGCATCCCAGG - Intergenic
1191222695 X:58006548-58006570 CTGAATCAGCCTTGCATCCCAGG - Intergenic
1191649666 X:63522937-63522959 TTGAAACAGCCTTGCATCCCAGG - Intergenic
1191803002 X:65102056-65102078 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1191969976 X:66802713-66802735 CTGAAACAGCCTTCCATCCCAGG - Intergenic
1192525528 X:71840244-71840266 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1192599560 X:72447259-72447281 CTGAACCAGCGTTGCATCCCAGG - Intronic
1193020229 X:76783822-76783844 TTGAACCAGCACTGCATCCCAGG + Intergenic
1193065924 X:77259918-77259940 TTGAAACAGCCTTGCATCCCAGG - Intergenic
1193158962 X:78206194-78206216 TTGAAACAGCTTTGCATCCCAGG - Intergenic
1193281170 X:79652716-79652738 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1193343422 X:80379267-80379289 TTGAACCAGCATTGCATCCCAGG + Intronic
1193374591 X:80743215-80743237 TTGAACCAGCCGTGCATCCCAGG + Intronic
1193477582 X:81985413-81985435 CTGAATCAGCCTTGCATCCCAGG - Intergenic
1193616470 X:83694221-83694243 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1193685800 X:84575360-84575382 TTGAACCAGCATTGCATCCCAGG - Intergenic
1193897589 X:87132209-87132231 TTGAAACAGCCTTGCATCCCAGG - Intergenic
1194139757 X:90195386-90195408 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1194640614 X:96399580-96399602 GTGAAACAGCACTTTATCCCAGG + Intergenic
1195204103 X:102578110-102578132 CTGAACCAGCCTTGCATCCCAGG - Intergenic
1195213395 X:102672046-102672068 CTGAACCAGCATTGAATACCTGG - Intergenic
1195441753 X:104906625-104906647 CTGAACCAGCCTTGCATCCCAGG + Intronic
1195984282 X:110612387-110612409 TTGAAACAGCCTTGCATCCCAGG - Intergenic
1196249984 X:113449123-113449145 TTGAAACAGCCTTGCATCCCAGG - Intergenic
1196546217 X:116967135-116967157 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1196606919 X:117667826-117667848 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1196842510 X:119871630-119871652 CCGAAACAGCCGTGGCTGCCTGG + Exonic
1197090222 X:122527795-122527817 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1197459935 X:126728468-126728490 CTGAAACATCCTTGCATCCCAGG - Intergenic
1197699062 X:129583413-129583435 CTGAATCAGGATTGGATCCCAGG - Intronic
1198314531 X:135452495-135452517 CTGACACTGCAGTGGGCCCCAGG + Intergenic
1200386983 X:155902688-155902710 CTGAACCAGCCTTGCATCCCAGG + Intronic
1200485501 Y:3764355-3764377 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1200583386 Y:4977054-4977076 TTGAAACAGCCTTGCATCCCAGG - Intergenic
1200819930 Y:7572372-7572394 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1201015253 Y:9594604-9594626 TTGAACCAGCCTTGGATCCCAGG - Intergenic
1202034403 Y:20617171-20617193 CTGAACCAGCCTTGCATCCCAGG + Intergenic
1202066549 Y:20946447-20946469 TTGAACCAGCCTTGGATCCCAGG + Intergenic
1202248945 Y:22849561-22849583 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1202401933 Y:24483309-24483331 TTGAAACAGCCTTGCATCCCAGG + Intergenic
1202468848 Y:25186774-25186796 TTGAAACAGCCTTGCATCCCAGG - Intergenic