ID: 1059302725

View in Genome Browser
Species Human (GRCh38)
Location 9:113328055-113328077
Sequence CAGAAGAAGGAGAAGCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059302717_1059302725 13 Left 1059302717 9:113328019-113328041 CCATGCCTGGCCAGTCCTTCGGC 0: 1
1: 0
2: 0
3: 34
4: 342
Right 1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG No data
1059302718_1059302725 8 Left 1059302718 9:113328024-113328046 CCTGGCCAGTCCTTCGGCATTTT 0: 1
1: 0
2: 2
3: 9
4: 182
Right 1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG No data
1059302721_1059302725 3 Left 1059302721 9:113328029-113328051 CCAGTCCTTCGGCATTTTAGGGT 0: 1
1: 0
2: 1
3: 4
4: 62
Right 1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG No data
1059302722_1059302725 -2 Left 1059302722 9:113328034-113328056 CCTTCGGCATTTTAGGGTGACCA 0: 1
1: 0
2: 1
3: 6
4: 52
Right 1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG No data
1059302715_1059302725 16 Left 1059302715 9:113328016-113328038 CCACCATGCCTGGCCAGTCCTTC 0: 1
1: 8
2: 128
3: 1107
4: 8382
Right 1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059302725 Original CRISPR CAGAAGAAGGAGAAGCAAGC TGG Intronic
No off target data available for this crispr