ID: 1059303913

View in Genome Browser
Species Human (GRCh38)
Location 9:113339302-113339324
Sequence TGTGACTTGCTGAAGGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059303906_1059303913 18 Left 1059303906 9:113339261-113339283 CCGACTGTTCTATTCCATGAAGA 0: 1
1: 0
2: 0
3: 18
4: 190
Right 1059303913 9:113339302-113339324 TGTGACTTGCTGAAGGTCACAGG No data
1059303909_1059303913 4 Left 1059303909 9:113339275-113339297 CCATGAAGAAACTGGGACTCAGA 0: 1
1: 1
2: 7
3: 55
4: 397
Right 1059303913 9:113339302-113339324 TGTGACTTGCTGAAGGTCACAGG No data
1059303905_1059303913 23 Left 1059303905 9:113339256-113339278 CCTATCCGACTGTTCTATTCCAT 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1059303913 9:113339302-113339324 TGTGACTTGCTGAAGGTCACAGG No data
1059303904_1059303913 29 Left 1059303904 9:113339250-113339272 CCAGTACCTATCCGACTGTTCTA 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1059303913 9:113339302-113339324 TGTGACTTGCTGAAGGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059303913 Original CRISPR TGTGACTTGCTGAAGGTCAC AGG Intronic
No off target data available for this crispr