ID: 1059305044

View in Genome Browser
Species Human (GRCh38)
Location 9:113347408-113347430
Sequence GCCATGGTAATTAGAGATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059305044_1059305047 2 Left 1059305044 9:113347408-113347430 CCACAATCTCTAATTACCATGGC No data
Right 1059305047 9:113347433-113347455 ATTTCCCTCCCCACCCCCAGAGG No data
1059305044_1059305057 23 Left 1059305044 9:113347408-113347430 CCACAATCTCTAATTACCATGGC No data
Right 1059305057 9:113347454-113347476 GGAGTGTAGATGCTGTTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059305044 Original CRISPR GCCATGGTAATTAGAGATTG TGG (reversed) Intergenic
No off target data available for this crispr