ID: 1059305045

View in Genome Browser
Species Human (GRCh38)
Location 9:113347424-113347446
Sequence GTGGGGAGGGAAATAGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059305045_1059305057 7 Left 1059305045 9:113347424-113347446 CCATGGCCTATTTCCCTCCCCAC No data
Right 1059305057 9:113347454-113347476 GGAGTGTAGATGCTGTTATGAGG No data
1059305045_1059305058 25 Left 1059305045 9:113347424-113347446 CCATGGCCTATTTCCCTCCCCAC No data
Right 1059305058 9:113347472-113347494 TGAGGCCATCACCCTCCCACTGG No data
1059305045_1059305059 26 Left 1059305045 9:113347424-113347446 CCATGGCCTATTTCCCTCCCCAC No data
Right 1059305059 9:113347473-113347495 GAGGCCATCACCCTCCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059305045 Original CRISPR GTGGGGAGGGAAATAGGCCA TGG (reversed) Intergenic
No off target data available for this crispr