ID: 1059305051

View in Genome Browser
Species Human (GRCh38)
Location 9:113347442-113347464
Sequence ATCTACACTCCTCTGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059305051_1059305061 17 Left 1059305051 9:113347442-113347464 CCCACCCCCAGAGGAGTGTAGAT No data
Right 1059305061 9:113347482-113347504 ACCCTCCCACTGGGATGCACTGG No data
1059305051_1059305059 8 Left 1059305051 9:113347442-113347464 CCCACCCCCAGAGGAGTGTAGAT No data
Right 1059305059 9:113347473-113347495 GAGGCCATCACCCTCCCACTGGG No data
1059305051_1059305058 7 Left 1059305051 9:113347442-113347464 CCCACCCCCAGAGGAGTGTAGAT No data
Right 1059305058 9:113347472-113347494 TGAGGCCATCACCCTCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059305051 Original CRISPR ATCTACACTCCTCTGGGGGT GGG (reversed) Intergenic
No off target data available for this crispr