ID: 1059305053

View in Genome Browser
Species Human (GRCh38)
Location 9:113347446-113347468
Sequence CAGCATCTACACTCCTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059305053_1059305059 4 Left 1059305053 9:113347446-113347468 CCCCCAGAGGAGTGTAGATGCTG No data
Right 1059305059 9:113347473-113347495 GAGGCCATCACCCTCCCACTGGG No data
1059305053_1059305061 13 Left 1059305053 9:113347446-113347468 CCCCCAGAGGAGTGTAGATGCTG No data
Right 1059305061 9:113347482-113347504 ACCCTCCCACTGGGATGCACTGG No data
1059305053_1059305058 3 Left 1059305053 9:113347446-113347468 CCCCCAGAGGAGTGTAGATGCTG No data
Right 1059305058 9:113347472-113347494 TGAGGCCATCACCCTCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059305053 Original CRISPR CAGCATCTACACTCCTCTGG GGG (reversed) Intergenic
No off target data available for this crispr