ID: 1059305055

View in Genome Browser
Species Human (GRCh38)
Location 9:113347448-113347470
Sequence AACAGCATCTACACTCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059305055_1059305059 2 Left 1059305055 9:113347448-113347470 CCCAGAGGAGTGTAGATGCTGTT No data
Right 1059305059 9:113347473-113347495 GAGGCCATCACCCTCCCACTGGG No data
1059305055_1059305058 1 Left 1059305055 9:113347448-113347470 CCCAGAGGAGTGTAGATGCTGTT No data
Right 1059305058 9:113347472-113347494 TGAGGCCATCACCCTCCCACTGG No data
1059305055_1059305061 11 Left 1059305055 9:113347448-113347470 CCCAGAGGAGTGTAGATGCTGTT No data
Right 1059305061 9:113347482-113347504 ACCCTCCCACTGGGATGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059305055 Original CRISPR AACAGCATCTACACTCCTCT GGG (reversed) Intergenic
No off target data available for this crispr