ID: 1059305056

View in Genome Browser
Species Human (GRCh38)
Location 9:113347449-113347471
Sequence TAACAGCATCTACACTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059305056_1059305061 10 Left 1059305056 9:113347449-113347471 CCAGAGGAGTGTAGATGCTGTTA No data
Right 1059305061 9:113347482-113347504 ACCCTCCCACTGGGATGCACTGG No data
1059305056_1059305058 0 Left 1059305056 9:113347449-113347471 CCAGAGGAGTGTAGATGCTGTTA No data
Right 1059305058 9:113347472-113347494 TGAGGCCATCACCCTCCCACTGG No data
1059305056_1059305066 30 Left 1059305056 9:113347449-113347471 CCAGAGGAGTGTAGATGCTGTTA No data
Right 1059305066 9:113347502-113347524 TGGAAACTTCTTTAGATGCCAGG No data
1059305056_1059305059 1 Left 1059305056 9:113347449-113347471 CCAGAGGAGTGTAGATGCTGTTA No data
Right 1059305059 9:113347473-113347495 GAGGCCATCACCCTCCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059305056 Original CRISPR TAACAGCATCTACACTCCTC TGG (reversed) Intergenic
No off target data available for this crispr