ID: 1059305057

View in Genome Browser
Species Human (GRCh38)
Location 9:113347454-113347476
Sequence GGAGTGTAGATGCTGTTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059305049_1059305057 -7 Left 1059305049 9:113347438-113347460 CCTCCCCACCCCCAGAGGAGTGT No data
Right 1059305057 9:113347454-113347476 GGAGTGTAGATGCTGTTATGAGG No data
1059305048_1059305057 -6 Left 1059305048 9:113347437-113347459 CCCTCCCCACCCCCAGAGGAGTG No data
Right 1059305057 9:113347454-113347476 GGAGTGTAGATGCTGTTATGAGG No data
1059305046_1059305057 1 Left 1059305046 9:113347430-113347452 CCTATTTCCCTCCCCACCCCCAG No data
Right 1059305057 9:113347454-113347476 GGAGTGTAGATGCTGTTATGAGG No data
1059305044_1059305057 23 Left 1059305044 9:113347408-113347430 CCACAATCTCTAATTACCATGGC No data
Right 1059305057 9:113347454-113347476 GGAGTGTAGATGCTGTTATGAGG No data
1059305045_1059305057 7 Left 1059305045 9:113347424-113347446 CCATGGCCTATTTCCCTCCCCAC No data
Right 1059305057 9:113347454-113347476 GGAGTGTAGATGCTGTTATGAGG No data
1059305050_1059305057 -10 Left 1059305050 9:113347441-113347463 CCCCACCCCCAGAGGAGTGTAGA No data
Right 1059305057 9:113347454-113347476 GGAGTGTAGATGCTGTTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059305057 Original CRISPR GGAGTGTAGATGCTGTTATG AGG Intergenic
No off target data available for this crispr