ID: 1059305058

View in Genome Browser
Species Human (GRCh38)
Location 9:113347472-113347494
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059305049_1059305058 11 Left 1059305049 9:113347438-113347460 CCTCCCCACCCCCAGAGGAGTGT No data
Right 1059305058 9:113347472-113347494 TGAGGCCATCACCCTCCCACTGG No data
1059305052_1059305058 6 Left 1059305052 9:113347443-113347465 CCACCCCCAGAGGAGTGTAGATG No data
Right 1059305058 9:113347472-113347494 TGAGGCCATCACCCTCCCACTGG No data
1059305053_1059305058 3 Left 1059305053 9:113347446-113347468 CCCCCAGAGGAGTGTAGATGCTG No data
Right 1059305058 9:113347472-113347494 TGAGGCCATCACCCTCCCACTGG No data
1059305055_1059305058 1 Left 1059305055 9:113347448-113347470 CCCAGAGGAGTGTAGATGCTGTT No data
Right 1059305058 9:113347472-113347494 TGAGGCCATCACCCTCCCACTGG No data
1059305050_1059305058 8 Left 1059305050 9:113347441-113347463 CCCCACCCCCAGAGGAGTGTAGA No data
Right 1059305058 9:113347472-113347494 TGAGGCCATCACCCTCCCACTGG No data
1059305051_1059305058 7 Left 1059305051 9:113347442-113347464 CCCACCCCCAGAGGAGTGTAGAT No data
Right 1059305058 9:113347472-113347494 TGAGGCCATCACCCTCCCACTGG No data
1059305046_1059305058 19 Left 1059305046 9:113347430-113347452 CCTATTTCCCTCCCCACCCCCAG No data
Right 1059305058 9:113347472-113347494 TGAGGCCATCACCCTCCCACTGG No data
1059305045_1059305058 25 Left 1059305045 9:113347424-113347446 CCATGGCCTATTTCCCTCCCCAC No data
Right 1059305058 9:113347472-113347494 TGAGGCCATCACCCTCCCACTGG No data
1059305054_1059305058 2 Left 1059305054 9:113347447-113347469 CCCCAGAGGAGTGTAGATGCTGT No data
Right 1059305058 9:113347472-113347494 TGAGGCCATCACCCTCCCACTGG No data
1059305056_1059305058 0 Left 1059305056 9:113347449-113347471 CCAGAGGAGTGTAGATGCTGTTA No data
Right 1059305058 9:113347472-113347494 TGAGGCCATCACCCTCCCACTGG No data
1059305048_1059305058 12 Left 1059305048 9:113347437-113347459 CCCTCCCCACCCCCAGAGGAGTG No data
Right 1059305058 9:113347472-113347494 TGAGGCCATCACCCTCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059305058 Original CRISPR TGAGGCCATCACCCTCCCAC TGG Intergenic
No off target data available for this crispr