ID: 1059306917

View in Genome Browser
Species Human (GRCh38)
Location 9:113360957-113360979
Sequence CTGGCTACACTGACTTAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 8, 2: 41, 3: 81, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059306917_1059306925 22 Left 1059306917 9:113360957-113360979 CCCTGCTAAGTCAGTGTAGCCAG 0: 1
1: 8
2: 41
3: 81
4: 199
Right 1059306925 9:113361002-113361024 ATCATCCTTGATATCTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059306917 Original CRISPR CTGGCTACACTGACTTAGCA GGG (reversed) Intronic
900804093 1:4755998-4756020 TTGGCTAAACTCACTTAGCAGGG + Intronic
900846637 1:5108547-5108569 CTGGCTAAACTAACTTAGCAAGG + Intergenic
900995605 1:6121722-6121744 CTGGCCTCTCTGACTTAGCCGGG - Intronic
901930091 1:12591606-12591628 CTGGCCACACTGCCTCAGCATGG + Intronic
902195406 1:14794461-14794483 CTGGCTACACCCATTTAGTAGGG - Intronic
905711415 1:40107605-40107627 CTCTCTAAACTGACTTAGCAAGG - Intergenic
906111758 1:43328475-43328497 CTGGCTTCTTTCACTTAGCATGG - Intergenic
906462950 1:46050918-46050940 CTGGCTTCTTTCACTTAGCATGG - Intronic
908395861 1:63725209-63725231 CTTGCTAAAATGACTTAGCAGGG - Intergenic
910310831 1:85822752-85822774 CTTGCTAAACCGACTTGGCAGGG - Intronic
910365908 1:86465344-86465366 CTGGCTAAACTGACTTGATAGGG + Intergenic
911416396 1:97580673-97580695 TTTGCTAAACTGACTTAGCAGGG - Intronic
911474520 1:98359252-98359274 CTGGCTAAAATGACTTAGCAGGG - Intergenic
913143871 1:115969856-115969878 CTGGCTACAATGACTAAACATGG + Intergenic
916217512 1:162410076-162410098 CTTGCCAAACTGACTTAGTAGGG - Intronic
916842712 1:168616144-168616166 GTTGCTAAACTAACTTAGCAGGG - Intergenic
918732103 1:188012037-188012059 CTTGCTAAACTGACTTAGCATGG + Intergenic
920055888 1:203191412-203191434 CTTGCTAAATTGACTTAGCAGGG - Intergenic
920189188 1:204181549-204181571 TTTGCTAAATTGACTTAGCAGGG + Intergenic
920286225 1:204881825-204881847 CTTGTCAAACTGACTTAGCAGGG - Intronic
921285605 1:213606448-213606470 CTCGCTGCCCTGACTTGGCAAGG - Intergenic
922232577 1:223699718-223699740 CTAGCTAAACTGACTTAGCAGGG - Intergenic
922679875 1:227584901-227584923 CTTGCTAAACTGACTTTTCAAGG + Intronic
922767558 1:228163791-228163813 CTGGCTAAACTGACTCAGTAGGG - Intergenic
922818218 1:228466354-228466376 CTAGTTAAACTGACTTAGCGGGG - Intergenic
923101002 1:230817448-230817470 CTAGTTAAACTGACTTAGCAGGG - Intergenic
924669125 1:246105199-246105221 CTGGCTAAATTGACTTAGCAGGG + Intronic
1062831657 10:609829-609851 CCGGCTGCACTGACCAAGCAGGG - Intronic
1063256135 10:4329247-4329269 CTTGCTAAACTGACTTTGCAGGG + Intergenic
1063843023 10:10092845-10092867 CGGGGTACACTGGCTTGGCAGGG + Intergenic
1064443370 10:15372104-15372126 CTTGGTAAACTGACTTAGCAGGG + Intergenic
1064488091 10:15818708-15818730 CTGGCTCCTTTCACTTAGCATGG - Intronic
1064585117 10:16832498-16832520 CTGGCTACTCTGTCATGGCAAGG - Intronic
1066435736 10:35395607-35395629 TCAGCTAAACTGACTTAGCAGGG + Intronic
1066443590 10:35461510-35461532 CTTGCTAATCTGACTTAGCAGGG + Intronic
1067495065 10:46754228-46754250 CCAGCTAAACTGACTTAGCAGGG + Intergenic
1067599590 10:47586168-47586190 CCAGCTAAACTGACTTAGCAGGG - Intergenic
1068139987 10:52993783-52993805 TTTGCTAAAATGACTTAGCAGGG - Intergenic
1069367455 10:67709572-67709594 CTTGCTAAACTGACTTAGCAGGG - Intergenic
1069800402 10:71078298-71078320 CTGGCTCCCCTGACTTTTCAGGG - Intergenic
1070064033 10:73016106-73016128 CTGGCTAACCTGACTTAGCAGGG - Intronic
1070286341 10:75086636-75086658 CCTGATAAACTGACTTAGCAGGG - Intergenic
1071513236 10:86280551-86280573 CCTGCTACAATGACTTAGGAGGG - Intronic
1071651116 10:87394052-87394074 CCAGCTAAACTGACTTAGCAGGG - Intergenic
1072135470 10:92541786-92541808 CTGGCTACACTGGCTTCTCCTGG + Intronic
1072925955 10:99617312-99617334 AAGGCTACACTGACTTCTCATGG + Intronic
1074848052 10:117416204-117416226 CTTGCTAAACTGACTTAGTGAGG + Intergenic
1075839721 10:125490433-125490455 CTGGCTATGCTCAGTTAGCATGG - Intergenic
1078708325 11:13766272-13766294 CTTGCTAAACTGACTTAGCAGGG + Intergenic
1080551664 11:33377685-33377707 CTTGATACACTGCCTTATCAAGG + Intergenic
1082701006 11:56430489-56430511 CTTGTTAAACTGACTTAGCGGGG + Intergenic
1082939560 11:58689721-58689743 ATTGCTAAACTGACTTAGCAAGG + Intronic
1083543809 11:63534376-63534398 CCTGCTAAACTGACTTGGCAGGG + Intergenic
1083712331 11:64556847-64556869 CTTGCTAAACTGATTCAGCAGGG + Intronic
1086980112 11:93187305-93187327 CTGGGAAAACTGACTTAGCATGG - Intronic
1087899593 11:103625882-103625904 CTTGTTAAATTGACTTAGCAAGG + Intergenic
1088078287 11:105878641-105878663 CTGGCTACAGTGGCTTTGCTGGG + Intronic
1091221161 11:133930851-133930873 AGGGCTGCACTGACTTAGGAAGG + Intronic
1091885940 12:4017065-4017087 CTTGCTAAACTGACTTTGCAAGG + Intergenic
1093738985 12:22658838-22658860 CTTGCTAAACTGACTCAGTAGGG + Intronic
1093958527 12:25249849-25249871 CTGTCTACACTCAACTAGCAAGG + Intronic
1094177180 12:27552991-27553013 CTTGCTAAACTGACTTAGCAGGG + Intronic
1099317092 12:81097634-81097656 CTGGCTAAAGTGAGTTAGGAGGG - Intronic
1099473437 12:83078046-83078068 CTTGCTGAACTGACTTAGCAGGG + Intronic
1100751370 12:97701983-97702005 CATGCTAAACTCACTTAGCAGGG - Intergenic
1100763753 12:97839389-97839411 CTTGCTAAACTGACTTAGCAGGG + Intergenic
1100958630 12:99937654-99937676 ATTGCTACACTGATTTAACAAGG + Intronic
1100989254 12:100234516-100234538 CTTGCTAAACTGACACAGCAGGG + Intronic
1101153834 12:101908729-101908751 CTTGCTAAACTGACTTAGCCAGG + Intronic
1102637485 12:114336804-114336826 CTGGCTAACCTGACTTAGCAGGG - Intergenic
1103703168 12:122858427-122858449 CTGGCTACACTCACCTGCCAAGG - Exonic
1103793396 12:123487240-123487262 CTGGCTCCTTTCACTTAGCACGG + Intronic
1104157277 12:126145522-126145544 CTGCTTAAATTGACTTAGCAGGG + Intergenic
1105370304 13:19796226-19796248 CTTGCTAAATTGACTCAGCAAGG + Intergenic
1105587591 13:21759212-21759234 TTGGCTAAACTGCCTTAGTAGGG + Intergenic
1105815430 13:24032055-24032077 CTTACTAAACTGACTTACCAGGG - Intronic
1106066054 13:26351408-26351430 CTGGCCACGCTGATTTAACAGGG - Intronic
1106332671 13:28754015-28754037 CTTGCTTAACTGACTTAGCAGGG - Intergenic
1106825789 13:33519024-33519046 CTTGTTAAGCTGACTTAGCAGGG - Intergenic
1107332068 13:39311965-39311987 CTGGCTAGAGTGACAGAGCATGG + Intergenic
1108523180 13:51263005-51263027 CCAGCTACACTGACCCAGCAGGG - Intronic
1109089040 13:58015837-58015859 CTGGCTAGACTGACTTAGCAGGG - Intergenic
1109187920 13:59292113-59292135 CTGGCTACAGTGGCTTTGCCAGG - Intergenic
1111339918 13:86870956-86870978 CTAGCTAACCTGATTTAGCAGGG - Intergenic
1111742092 13:92217344-92217366 CTTGATAAACTGACTTAGCAGGG - Intronic
1112074096 13:95889799-95889821 CTGGCTACACTGAATGACAAGGG - Intronic
1112278706 13:98044266-98044288 CTGGCTAAACTGACTTAGCAGGG + Intergenic
1112904537 13:104400805-104400827 CTTGCTAAAGTGACTTAGCAGGG - Intergenic
1113676473 13:112210410-112210432 CTTGCTAAACTGACTTTGCAGGG + Intergenic
1114676784 14:24446521-24446543 CTTGCTAAACTGACTTAGCAAGG - Intergenic
1116189798 14:41649586-41649608 CTTGCTAAACTGACGCAGCAGGG - Intronic
1117087273 14:52214581-52214603 CTTGCTAAACTGACTTAGCAAGG - Intergenic
1117626731 14:57647740-57647762 CTGGTTAAAGTGACTTAGCAGGG - Intronic
1121288756 14:92757385-92757407 CTTGCCAAACTGACTTAGCAGGG + Intergenic
1121909519 14:97776362-97776384 CTTGCTAACCTGACTTAGCAGGG - Intergenic
1124136351 15:27039217-27039239 CTTGCCAGACTGACTTAGCTGGG + Intronic
1125359430 15:38849962-38849984 CTGGCTTCATGGACTAAGCAGGG + Intergenic
1126493747 15:49267386-49267408 CTCACTAAACTGATTTAGCAAGG + Intronic
1128480328 15:68032054-68032076 CTTGCTAAATTGACTTAGCAGGG - Intergenic
1128820697 15:70650138-70650160 CTTGCTAAACTGACTTGGTAGGG + Intergenic
1129141945 15:73606894-73606916 CTTGCTAAACTGACTTAGCAAGG - Intronic
1131224867 15:90616210-90616232 CTGGGAACACTGACAAAGCATGG + Intronic
1131628755 15:94152979-94153001 CAGGCTACTCTGACTTAGCCTGG + Intergenic
1132085797 15:98907405-98907427 CTGGCTACGCTGGCTCTGCAGGG + Intronic
1132467341 16:83401-83423 CTGGCTACGCTGACGGGGCAGGG + Intronic
1133157214 16:3883592-3883614 CTGCCTGCACTCACTTAGCTGGG + Intergenic
1133521688 16:6564520-6564542 CTGGCTTATCTCACTTAGCACGG - Intronic
1135514808 16:23122673-23122695 CTGGCTTCTTTCACTTAGCATGG - Intronic
1135674098 16:24400699-24400721 GTGGCTTCCCTCACTTAGCATGG - Intergenic
1136085063 16:27878944-27878966 CTGGCTAAATTGACTCAACAGGG + Intronic
1141458885 16:84164535-84164557 CTGGCTTCTTTCACTTAGCAAGG + Intronic
1203116230 16_KI270728v1_random:1493430-1493452 CTAGCTAATCTCACTTAGCAAGG + Intergenic
1143730845 17:8881880-8881902 CTGGCTACACTGCATTTCCAGGG - Exonic
1144220756 17:13097721-13097743 CTGGCTAAACTGACTTACCAGGG + Intergenic
1144587235 17:16494467-16494489 CTTGCTAAACTGTCTTAACAGGG + Intergenic
1144588206 17:16501795-16501817 CTTGCTAAACTGACTTAGCACGG - Intergenic
1144999037 17:19290582-19290604 CTGGCTCCGCAGACTCAGCAAGG - Intronic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1150755666 17:67910140-67910162 CTGGCTTCATCCACTTAGCATGG + Intronic
1151231683 17:72689665-72689687 CTGGCTGCTTTCACTTAGCATGG - Intronic
1153134937 18:1905867-1905889 CTGGCTAAACTGACTTAATAGGG + Intergenic
1153354590 18:4121432-4121454 CTTGCCAAAGTGACTTAGCAGGG - Intronic
1155324799 18:24655053-24655075 CTGTCTAAACTGACTTAACAGGG - Intergenic
1155590076 18:27417888-27417910 CTGGCCTCTTTGACTTAGCATGG + Intergenic
1157345565 18:46828088-46828110 CTGGCTACAGTCACTGAACAAGG + Exonic
1157593902 18:48852310-48852332 CTAGCCACACTTACTCAGCAGGG - Intronic
1158512545 18:58104184-58104206 CTGGCTTCTTTCACTTAGCATGG - Intronic
1159292532 18:66440534-66440556 CCGGGTACGCTGACTAAGCAGGG - Intergenic
1159507457 18:69355834-69355856 CTTGCTAAACTGACTTAGCAGGG - Intergenic
1160005809 18:75068265-75068287 CTGGCTAAACCGATTTGGCAGGG + Intergenic
1163407307 19:17130929-17130951 CCTGTTAAACTGACTTAGCAGGG - Intronic
1164468698 19:28510173-28510195 GGTGCTACCCTGACTTAGCAGGG + Intergenic
1165401511 19:35603654-35603676 CTAGCTAAACTGACGTAGAAGGG + Intergenic
1165492402 19:36132078-36132100 CTCGATAAACTGACTTAGCAGGG + Intergenic
1165682757 19:37791496-37791518 CTTGCTAAACTGACTTAAAAGGG + Intronic
1166266060 19:41685212-41685234 CTCTCTACACTGACTCACCAGGG - Intronic
1166270766 19:41712082-41712104 CTCCCTACACTGACTCACCAGGG + Intronic
1166423815 19:42658253-42658275 CTCTCTACATTGACTCAGCAGGG + Intronic
1166661498 19:44650160-44650182 CTGTCTACACTGACTCCCCAAGG + Intronic
926225325 2:10962897-10962919 CTGGCTTCTTTCACTTAGCATGG + Intergenic
927064777 2:19460467-19460489 CTTGCTAAACTGATTTAGCAGGG - Intergenic
927251400 2:20997846-20997868 CCGGCTTCAGTGACTTACCAAGG + Intergenic
928507987 2:31973689-31973711 CTGGCTTCTTTCACTTAGCATGG - Intronic
930219118 2:48727754-48727776 CTGGCTACACTGTCATCTCATGG + Intronic
930411945 2:51035226-51035248 CTTGCTACACTGACTTTGAACGG + Intergenic
932788743 2:74633333-74633355 CTCGCCAAACTGACTTAGCAGGG - Intronic
932986798 2:76736182-76736204 CTTGCTAAACTGACTTAGCAGGG - Intergenic
934698178 2:96415662-96415684 CTGGCTAAACCAACTTAGCAGGG - Intergenic
935266585 2:101400304-101400326 CTCGCTAAAGTGACTCAGCAGGG - Intronic
935390164 2:102542616-102542638 CTTGCTAAACTGACTTAGAAGGG + Intergenic
935539578 2:104333819-104333841 AGGGCTATACTGACTTAGCAGGG + Intergenic
935736266 2:106108911-106108933 CTTGTGAAACTGACTTAGCAGGG - Intronic
936129311 2:109821050-109821072 CTGGCTTCTTTGATTTAGCAAGG + Intronic
936215386 2:110550435-110550457 CTGGCTTCTTTGATTTAGCAAGG - Intronic
936424523 2:112405008-112405030 CTGGCTTCTTTGATTTAGCAAGG - Intronic
937278212 2:120699936-120699958 CTTGCTAAACTGGGTTAGCAGGG - Intergenic
937840942 2:126524005-126524027 CTTACTAAACTGACTTAGCAGGG + Intergenic
938119170 2:128621915-128621937 CTTGCTAACCTGACCTAGCAAGG - Intergenic
938182879 2:129199593-129199615 CTTGTTAAACTGACTTAGCAGGG - Intergenic
938337492 2:130512403-130512425 CTTGCTAAACTGACTTACCAAGG - Intergenic
938352347 2:130608332-130608354 CTTGCTAAACTGACTTACCAAGG + Intergenic
939664472 2:144934021-144934043 TTGGAAACACTGACTTAGCATGG - Intergenic
939936952 2:148304743-148304765 CTGGCTGAACTGACTTGACAGGG + Intronic
940449215 2:153817360-153817382 CTTGCTAAACTGATTTATCAGGG - Intergenic
942857811 2:180571914-180571936 CTGGCTTCTTTCACTTAGCATGG - Intergenic
943218114 2:185065473-185065495 CTGGCTGAACTGACTTTGCAGGG + Intergenic
944774417 2:202948086-202948108 CTGGCACCATTTACTTAGCAGGG + Intronic
945302989 2:208231698-208231720 CTTGCTAAAGTGACTTGGCAGGG - Intergenic
945356099 2:208841390-208841412 TTTGCTAAACTAACTTAGCAGGG + Intronic
945628230 2:212237803-212237825 CTGGCTACATCGGCTTTGCAGGG + Intronic
946015996 2:216604436-216604458 CTTGCTAGACTGATTTAGCAGGG + Intergenic
946494746 2:220184525-220184547 TTTGCTAGACTGACTTAGCAGGG - Intergenic
946833057 2:223744706-223744728 CTGGTCACACTGACACAGCATGG + Intergenic
947366927 2:229406188-229406210 GTGGCCACAGTGGCTTAGCAGGG + Intronic
947395891 2:229686436-229686458 CTGGCCAACCTGACTTAGCCTGG + Intronic
947445077 2:230157068-230157090 CTCTCCACACTGACTTAGGAGGG - Intergenic
948751846 2:240137658-240137680 CTGGCTAAACCAACTTAGCAGGG - Intergenic
1169830329 20:9818123-9818145 TTTGCTAAACTGACTTAGCAGGG - Intronic
1170418099 20:16165730-16165752 CTTGCTAAACTGACTTATCAGGG + Intergenic
1170589978 20:17764572-17764594 CTGGCGGCACTGCCTCAGCAGGG + Intergenic
1173259260 20:41418877-41418899 CCCTCTACTCTGACTTAGCAAGG + Intronic
1177403464 21:20636367-20636389 CTTGGTAAACTGACTTAGCAGGG + Intergenic
1177415552 21:20788509-20788531 CTTGCTAAACTGACTTAGCTGGG + Intergenic
1179455839 21:41499433-41499455 CTGGCTAAACTGACTGAGCAAGG - Intronic
1179794588 21:43775761-43775783 CTGGCTAAACTGACTTAGCCAGG - Intronic
1179891219 21:44335979-44336001 CTGGGCACACTGGCTGAGCAGGG - Intronic
1179891235 21:44336031-44336053 CTGGGCACACTGGCTGAGCAGGG - Intronic
1179891251 21:44336083-44336105 CTGGGCACACTGGCTGAGCAGGG - Intronic
1179891267 21:44336135-44336157 CTGGGCACACTGGCTGAGCAGGG - Intronic
1180730461 22:17978263-17978285 CTGGCTGCTTTCACTTAGCATGG - Intronic
1181016445 22:20071839-20071861 CTTGCTAAAGTGACTTTGCAGGG + Intergenic
1183682902 22:39344343-39344365 CTTGCTAAACTGACTTAGGAGGG + Intergenic
1185175751 22:49325571-49325593 CTGGCTACACTGACCCAACAGGG - Intergenic
949300808 3:2581868-2581890 CTGGCTTCATTCACTTAGCACGG - Intronic
951591245 3:24267552-24267574 TTGGTTAAACTGACTTAGCAGGG - Intronic
951693219 3:25418792-25418814 CTGGCCAAACTGACTCAGAAAGG + Intronic
952875061 3:37937772-37937794 CTTGCTAAACTGATTTAGCAGGG + Intronic
954667182 3:52262128-52262150 CTGGCTTCTTTTACTTAGCATGG - Intronic
954685535 3:52368190-52368212 CTGGCTAAACTGACTTAGCAGGG + Intronic
955302054 3:57789540-57789562 CTGGCTAAACTGACTTAGCAAGG + Intronic
956791730 3:72685251-72685273 CTGACTTCACAGACGTAGCAGGG + Intergenic
957219371 3:77362511-77362533 CTTGCTAAACTGACTTAGCAGGG + Intronic
957782248 3:84834577-84834599 TTAGCTAAACTGATTTAGCAGGG + Intergenic
958055423 3:88404900-88404922 CTTATTAAACTGACTTAGCAAGG - Intergenic
958979840 3:100708627-100708649 CTCACTACACTGCCTTAACAAGG - Intergenic
959051573 3:101529385-101529407 CTTGCTAAACTGACTTAGCAGGG - Intergenic
959770596 3:110090510-110090532 CTTTCTAAACTGACTTGGCAGGG + Intergenic
959842514 3:110994548-110994570 CTTGCTAAACTGACTTAGTTGGG + Intergenic
959856977 3:111170793-111170815 CTTGCTAAACTAACTTAGCAGGG + Intronic
960924935 3:122785369-122785391 CTTGCTAAACTGACTTAGCAAGG - Intronic
962107988 3:132413824-132413846 TTGGCTAAACTGACTTAGCCAGG - Intergenic
962581748 3:136804301-136804323 CTTGCTAAACCAACTTAGCAGGG - Intergenic
963774404 3:149423354-149423376 CTTGCTAAACTGACTTAGCAGGG + Intergenic
964016050 3:151948134-151948156 CTGGCTAAACAGTCTTAACAGGG + Intergenic
964275129 3:155001380-155001402 CTTGCTAAACAGACTCAGCAGGG - Intergenic
965463122 3:168993500-168993522 TTGGCCAAACTTACTTAGCAGGG - Intergenic
965681858 3:171260025-171260047 CTAGCTAAACTGACTTAGCAGGG - Intronic
966238473 3:177728610-177728632 CCTGCTAAACTGACTTAGCAGGG + Intergenic
968779079 4:2565544-2565566 GTGGCTACTCTGGCTGAGCACGG - Intronic
970586824 4:17522543-17522565 CAGGCCCCAGTGACTTAGCAAGG - Intronic
971025462 4:22585025-22585047 CTTGCTAAACTGACTTAGTAGGG - Intergenic
971731884 4:30394727-30394749 CTGGCTACACTGTACTAGGAAGG + Intergenic
973177383 4:47224620-47224642 CTTGCTAAACTGACTTAGTGGGG + Intronic
975649973 4:76583232-76583254 TTGTCTGCACTGACTTAGGACGG + Intronic
976871644 4:89801070-89801092 CTGCCTGCACTGGCCTAGCAGGG - Intronic
978926183 4:114248454-114248476 CTTGCTAAACTGACTTAGAAAGG - Intergenic
979129650 4:117026409-117026431 CTTGCTAAACTGACTTAGCAGGG + Intergenic
980653802 4:135756093-135756115 CTTGGTAAACTGATTTAGCAAGG + Intergenic
980843432 4:138295079-138295101 CTGGCAACACTAACTCAGCTAGG + Intergenic
983034174 4:162842253-162842275 CCTGCTATAATGACTTAGCAGGG - Intergenic
984279336 4:177650159-177650181 CTTGCTAAACTGATTTAGCAGGG - Intergenic
986339667 5:6778318-6778340 CTGGCCTCACTGACAGAGCATGG + Intergenic
986613674 5:9594673-9594695 CTTGCTAAACTGACTTGGCCGGG + Intergenic
987148208 5:15013027-15013049 CTTGCTAAAGTGACTTAGTAGGG + Intergenic
987259791 5:16191863-16191885 CTCACTGAACTGACTTAGCAGGG - Intergenic
987854104 5:23396593-23396615 CTTGCTAAACTGACTTAGCAGGG - Intergenic
988589056 5:32533201-32533223 CTGGCTACACCTACTTGTCAGGG - Intronic
989654728 5:43734215-43734237 CTGGCCACACTGCCTTGGGAAGG + Intergenic
990276372 5:54201458-54201480 CTTGCTGAACTGACTTAGCCAGG - Intronic
990440136 5:55836153-55836175 GTGGTTACACTAACTCAGCAGGG - Intergenic
992288626 5:75262067-75262089 CTTGCTAAACTGACTTAGCAGGG - Intergenic
992297298 5:75337662-75337684 CTGCCTACTCTGACTGAACAGGG - Intronic
993953361 5:94202048-94202070 CTGGCTAAACTGATTTAGCAAGG + Intronic
994147003 5:96406530-96406552 ATGGCTACAGTGGCTAAGCAAGG - Intronic
997213490 5:132092078-132092100 CTGGCTACCCTCACTTAATATGG + Intergenic
998417922 5:141958968-141958990 CTGCCCACACTGACTTATGAGGG + Exonic
998446515 5:142203048-142203070 CTGGCTAAACTGTCTTGGGAAGG + Intergenic
999050871 5:148522784-148522806 CTGGCTAAACAAACCTAGCAGGG + Intronic
1000273403 5:159709423-159709445 CTTGCTAAACTGATTTAGCAGGG + Intergenic
1001402825 5:171456163-171456185 CTTGCTAAACTGACTTAGCAGGG - Intronic
1001483555 5:172104473-172104495 CTGGCTGTACTGCCTTAGAATGG - Intronic
1001829031 5:174769859-174769881 CTGGCTCCAATCACTCAGCAAGG - Intergenic
1003173502 6:3738043-3738065 CTGGCCACACTCACTTTACAGGG + Exonic
1003605262 6:7553953-7553975 CTGGCTGCACTGTCTCACCATGG - Intronic
1005419856 6:25637846-25637868 CTTGCTAAAGTGACTTAGCAAGG + Intergenic
1005660627 6:27995524-27995546 CTGGCTAAGATGACTTATCATGG - Intergenic
1005762274 6:28978155-28978177 CTTGCTAAACTGACTTGGCAGGG - Intergenic
1007044558 6:38759647-38759669 CTTGCTAAACTGACTTAGCAGGG - Intronic
1008486840 6:52045767-52045789 CTACCTACACTGAGTTAGGAAGG + Intronic
1010917486 6:81638466-81638488 CTTGTTAAACTGACTTAGCAAGG - Intronic
1012497016 6:99844679-99844701 TTTGCCAAACTGACTTAGCAGGG - Intergenic
1012669311 6:102020596-102020618 CTTGCTAAACTGACTTAACAGGG + Intronic
1014854317 6:126380971-126380993 CTTGCCAAACTGTCTTAGCAGGG - Intergenic
1015978872 6:138818883-138818905 CTTCCTAAACTGACTTAACAGGG + Intronic
1016583955 6:145662786-145662808 CTTGCTAAATTGACTTAGCTGGG + Intronic
1016877897 6:148881726-148881748 CTGGCTACTCTGCCTTGTCAAGG - Intronic
1020591120 7:10138447-10138469 CTGGCTAAACTGATTTAGCCAGG - Intergenic
1022159583 7:27695721-27695743 CTTGCTAAACTGACTTAGCAGGG + Intergenic
1022378830 7:29840980-29841002 CTTGCTAAACCGACGTAGCAGGG + Intronic
1023149438 7:37187181-37187203 CTGGCTTCTTTCACTTAGCATGG - Intronic
1025006909 7:55362647-55362669 CTTCCTAAAGTGACTTAGCAAGG + Intergenic
1025963445 7:66245520-66245542 CTTGCTAAACTGCCTTAGCAGGG + Intronic
1026288667 7:68986375-68986397 CTTGCTAAACTGACTTAGCAGGG - Intergenic
1026863052 7:73806077-73806099 CTGGCTAAATTGACTTAACCAGG - Intronic
1027699952 7:81457452-81457474 CTTGCTAAAATGACTTAACAGGG - Intergenic
1030845252 7:114401111-114401133 CTAGCTAAACTGACTTAGTAGGG + Intronic
1030947536 7:115742415-115742437 CTGGCTTCTTTCACTTAGCATGG - Intergenic
1033231245 7:139599902-139599924 CTTGCTAAACTGACTTAGCAAGG - Intronic
1033991044 7:147287374-147287396 CTTGCTAAACTGACTTAGCAGGG + Intronic
1033993000 7:147311101-147311123 CTGGCTAAACTGACTTCGCAGGG + Intronic
1035241477 7:157533430-157533452 CTTGCTAAACTGACTTAACATGG - Intergenic
1039230933 8:35447168-35447190 TTGGCTAAACTCACTTAGCAAGG + Intronic
1039733925 8:40309599-40309621 CTGGCTAAACTGACTTAGCAGGG - Intergenic
1039734251 8:40313927-40313949 CTGGCTAAACTGACTTAGCAGGG - Intergenic
1039850340 8:41359170-41359192 CTGGCTAACCTGATTTAGCAGGG + Intergenic
1041322336 8:56626216-56626238 CTTGACAAACTGACTTAGCAAGG - Intergenic
1041550203 8:59091811-59091833 GTGGCAGCACTGACCTAGCATGG - Intronic
1041652721 8:60316983-60317005 CAGGCTAAACTGACTTAGCAGGG - Intergenic
1044123090 8:88422670-88422692 CTTGCTAAACTAACTTTGCAGGG - Intergenic
1045892579 8:107174927-107174949 TTGGCTGTACTGACTTAGAATGG - Intergenic
1047565911 8:126043381-126043403 CTGGCTACACAGAATGAGCTAGG + Intergenic
1048567319 8:135615133-135615155 CTTGCTAAACTGGCTCAGCAAGG + Intronic
1049201414 8:141342323-141342345 CTGGCTTCTTTCACTTAGCACGG + Intergenic
1049297454 8:141850272-141850294 CTTGATAAACTGACTTAGCAGGG + Intergenic
1049383383 8:142328859-142328881 CTGGCCACACTGGCCTTGCATGG + Intronic
1052804696 9:33002387-33002409 CTTGGTAAACTGACTTAGCCAGG - Intronic
1053185380 9:36011925-36011947 CTTGCTGAACTGACTTAGCAGGG + Intergenic
1053537181 9:38937572-38937594 CTTACTAAACTGACTTAGCAGGG + Intergenic
1053809821 9:41840544-41840566 CTTGCTAAATTGACTTAGCGGGG + Intergenic
1054620772 9:67346884-67346906 CTTGCTAAATTGACTTAGCGGGG - Intergenic
1054628954 9:67426358-67426380 CTTACTAAACTGACTTAGCAGGG - Intergenic
1056520736 9:87398980-87399002 CTGGCTGCTCTTACTTAGAAAGG + Intergenic
1057377033 9:94534482-94534504 CTTGCTAAACTGACTTAGCAGGG - Intergenic
1058368519 9:104236522-104236544 CTGTGAACACTGAGTTAGCAGGG - Intergenic
1058577727 9:106421563-106421585 CTAGCTACATTCACTTACCATGG + Intergenic
1059306917 9:113360957-113360979 CTGGCTACACTGACTTAGCAGGG - Intronic
1059350317 9:113659632-113659654 CTGGTTACACTGACTTAGCAGGG + Intergenic
1061494453 9:130963707-130963729 CTGACCACACTGATTTAGCAGGG + Intergenic
1061874979 9:133539175-133539197 CTGGCTGCACTGCCCTAGGAGGG - Intronic
1062314909 9:135962107-135962129 CTTGCTAAACTCACTTATCAAGG - Intergenic
1185986824 X:4844555-4844577 CTTGCTAAACTGGCTTAGCAGGG - Intergenic
1186244342 X:7605149-7605171 CCTGCCAAACTGACTTAGCAGGG - Intergenic
1186405768 X:9300951-9300973 CGGGCTTCACTCACTCAGCACGG + Intergenic
1186550253 X:10497374-10497396 CTGGCTAAACCAACTCAGCAGGG - Intronic
1186858807 X:13651513-13651535 TTGGCTAAACTGATTTATCAAGG - Intergenic
1187549749 X:20290366-20290388 CTGGCCACACTGAGTTGCCAGGG - Intergenic
1188988807 X:36792056-36792078 CTTTCTTAACTGACTTAGCAGGG - Intergenic
1190110198 X:47584378-47584400 CTTGCTAAACTGACTTAGCAAGG + Intronic
1190379741 X:49828369-49828391 CATGCCACATTGACTTAGCAGGG + Intergenic
1192614237 X:72601578-72601600 CTGGCTAAACTGACTTAGCAGGG + Intronic
1193552501 X:82914381-82914403 GTTGCTAAACTGACTTAACAGGG - Intergenic
1194062281 X:89218485-89218507 CTGGCTAAACTGGCTTAGCAGGG - Intergenic
1194770826 X:97902814-97902836 CTTGCTAAACTGACTTAGCAGGG - Intergenic
1195652370 X:107298533-107298555 CTTGCTAAACAGACTTAGCAGGG + Intergenic
1198507146 X:137312282-137312304 TGGGCTAGACTGACTTACCAAGG - Intergenic
1199940006 X:152616003-152616025 CTAGTTATTCTGACTTAGCATGG - Intergenic
1200716148 Y:6547451-6547473 CTGGCTAAACTGGCTTATCACGG - Intergenic
1201238458 Y:11934437-11934459 CTGGCTTCATTCACTAAGCATGG - Intergenic
1201354554 Y:13083333-13083355 CTGGGTACACACACTTTGCATGG - Intergenic
1201676886 Y:16595922-16595944 CTGGTCTCACTGACTTATCATGG - Intergenic