ID: 1059309771

View in Genome Browser
Species Human (GRCh38)
Location 9:113380250-113380272
Sequence CTTTGGAAGGCTAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205347
Summary {0: 3, 1: 234, 2: 5941, 3: 59931, 4: 139238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059309766_1059309771 -8 Left 1059309766 9:113380235-113380257 CCTGAAATCCTAGCACTTTGGAA No data
Right 1059309771 9:113380250-113380272 CTTTGGAAGGCTAAGGTGGAAGG 0: 3
1: 234
2: 5941
3: 59931
4: 139238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059309771 Original CRISPR CTTTGGAAGGCTAAGGTGGA AGG Intergenic
Too many off-targets to display for this crispr