ID: 1059310712

View in Genome Browser
Species Human (GRCh38)
Location 9:113387338-113387360
Sequence GTGCTCTGAAGGAGGTCACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059310712_1059310715 -5 Left 1059310712 9:113387338-113387360 CCTGGTGACCTCCTTCAGAGCAC 0: 1
1: 0
2: 2
3: 13
4: 158
Right 1059310715 9:113387356-113387378 AGCACCTGTCACCACATCACTGG 0: 1
1: 0
2: 2
3: 12
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059310712 Original CRISPR GTGCTCTGAAGGAGGTCACC AGG (reversed) Exonic
900624136 1:3600476-3600498 ATGCTCTGAAGGAGGACAGGCGG + Intronic
904371126 1:30048012-30048034 GTTCTCTGCTGAAGGTCACCGGG - Intergenic
905344023 1:37299284-37299306 GTCCTCTGAAGGTGGGCTCCAGG - Intergenic
905924376 1:41739449-41739471 GTGCTCTGTGGGCGGTCACTTGG - Intronic
906241812 1:44246840-44246862 CTACTCTGAAGGAGGTGACTGGG + Intronic
915367652 1:155324597-155324619 GTGCCCTGAGGGAGGGCACAGGG + Intronic
915773832 1:158460618-158460640 CCGCTCAGAAGGAGGTGACCTGG - Intergenic
916684896 1:167135462-167135484 GTGCTCAGAAGGAGATTATCGGG + Intergenic
917638718 1:176961497-176961519 GTCCTCTGAAGCTGGTCATCTGG + Intronic
919981559 1:202645182-202645204 ATGCTCAGCAGGAGGGCACCAGG + Intronic
922198312 1:223379251-223379273 TTGCTCTAAAGGAGCTTACCAGG - Intergenic
1063203802 10:3811443-3811465 GTGTTCTGAAGGAGCTCACAGGG + Intergenic
1063715921 10:8527027-8527049 GTGCTATGAATGAGGACAACAGG + Intergenic
1069408187 10:68124619-68124641 CTGCCCTCAAGGAGGTCAGCAGG - Intronic
1073201874 10:101741777-101741799 GTGCACTGAATGGGCTCACCTGG + Intergenic
1074263954 10:111882566-111882588 GTGTTCTTAAGTAGGTCACTTGG - Intergenic
1075207774 10:120461920-120461942 GTGCCCTCAAGCAAGTCACCTGG - Intronic
1077032673 11:476647-476669 GAGCTCTGGCGCAGGTCACCTGG + Intronic
1078687795 11:13549229-13549251 CTGCTCTGATGGAGGTTACAGGG + Intergenic
1080578727 11:33623760-33623782 TGGCTCTGAAGGAGGTCACTAGG - Intronic
1081351749 11:42062179-42062201 CTGCTCTGAAGGAGCTTACAGGG + Intergenic
1081412485 11:42776249-42776271 GGGCACTGAAGGAGATCAACAGG - Intergenic
1084422472 11:69067209-69067231 GTGGCCTGAGGGAGGTCACTAGG + Intronic
1084606496 11:70175405-70175427 GTCCTCTCAAGGAGCTCGCCTGG - Intronic
1084772704 11:71354293-71354315 GTGCCCTGAAGGAGGCCATCAGG + Intergenic
1085027279 11:73243614-73243636 GTGCTGTGAATGAGGGCATCTGG - Intergenic
1085033242 11:73285419-73285441 GTGCAATGTAGGAGGTCAGCAGG - Intronic
1086256275 11:84880367-84880389 GGGCTCTGAAATAAGTCACCCGG - Intronic
1089048436 11:115524772-115524794 GTGCTTGGAAGCAGGGCACCAGG - Intergenic
1090006064 11:123003250-123003272 CTGAGCTGCAGGAGGTCACCTGG - Intergenic
1095357178 12:41289042-41289064 CTGCTCTGAAGGAGGTGAGATGG + Intronic
1096527253 12:52217874-52217896 TTGCTCTAAAGGACATCACCGGG - Intergenic
1098025926 12:66201357-66201379 GTTATCTGAAGGTGGTCACGGGG - Intronic
1104357575 12:128101334-128101356 GTGTTCTCAAGGAGGTCCCTGGG - Intergenic
1105777407 13:23676582-23676604 CTCCTCTGCAGGAGGACACCTGG - Intergenic
1106199982 13:27528052-27528074 GTGCTCTGCAGGAGATAACTTGG + Intergenic
1109049364 13:57458621-57458643 GTGCTATGAAATAGGTCACATGG - Intergenic
1113417351 13:110138537-110138559 GCGCGCGGAAGGCGGTCACCTGG - Intergenic
1115445805 14:33488139-33488161 GAGCTCTGAAGGAGGTAAGAAGG + Intronic
1115503192 14:34067512-34067534 GTGCTCTGAAGGAAATAAACAGG + Intronic
1117374803 14:55110557-55110579 GTGGTCTGATGGAGGTGAACTGG - Intergenic
1119128586 14:72151188-72151210 GTGTGCTGAAGGAGGAAACCTGG + Intronic
1119681894 14:76598889-76598911 GGGCTGTGAAGGAGGCAACCAGG + Intergenic
1120469565 14:84904831-84904853 TTGCTCTGCAGGAGGACACCTGG - Intergenic
1123215777 14:106808116-106808138 GGGTTCAGAATGAGGTCACCTGG - Intergenic
1123393329 15:19899595-19899617 GGGCCCTGAAGGAGGTGTCCGGG - Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1124497246 15:30193918-30193940 ATGCTCAGCAGGAGGGCACCAGG + Intergenic
1124746328 15:32344729-32344751 ATGCTCAGCAGGAGGGCACCAGG - Intergenic
1127824893 15:62694469-62694491 CTGCTCTGAAGCCTGTCACCTGG + Intronic
1130907567 15:88251415-88251437 GTGCCCTGATGGAGCTCACAGGG + Intronic
1131128830 15:89880959-89880981 GTGCCCTGAAGGAAGTAAACAGG + Intronic
1132054072 15:98635873-98635895 GACCTCTGAAGGGGGTCACAAGG - Intergenic
1132548319 16:543765-543787 GTGCTCCGACGGAGGGCGCCGGG + Intronic
1132675566 16:1119922-1119944 GTGCCCTGGAGGAGGGCCCCAGG - Intergenic
1133001111 16:2852237-2852259 GGGCTCTGATGGGGCTCACCTGG + Intergenic
1133865467 16:9637882-9637904 CTGCTCTTAAGAAGGTCATCAGG + Intergenic
1134122677 16:11596254-11596276 CTGCCCTGAAGCAGGTAACCCGG - Intronic
1135662131 16:24306080-24306102 GTGCTTTGATGGAAGCCACCAGG + Intronic
1141809898 16:86368831-86368853 GTGTTTTGAAGGAGCTCTCCGGG - Intergenic
1143244494 17:5471735-5471757 GTGTTCTGTAGGATGTCTCCAGG - Exonic
1144410379 17:14994956-14994978 GAGTTCTGAAGGACTTCACCTGG + Intergenic
1146754014 17:35410035-35410057 GTGCACTGAAGGAGCTCCACTGG - Intergenic
1146942821 17:36855490-36855512 CTGCTCTGAGGGAGCTCAGCAGG + Intergenic
1147182244 17:38693707-38693729 TTGCTCTGCCGCAGGTCACCAGG - Intergenic
1150410308 17:64936488-64936510 GTGCCCTGAAGGAGCTCAGGAGG - Intergenic
1159230302 18:65598586-65598608 GTGATCTGAGGGAGATCACAAGG + Intergenic
1159658469 18:71061970-71061992 CTGCACTGAAGCAGCTCACCAGG - Intergenic
1160673838 19:378219-378241 CTGCTCTGAACGAGGTCTCCTGG - Intergenic
1161085225 19:2332101-2332123 GGGCTCTGGGGGAGGTCACATGG + Intronic
1163466534 19:17471123-17471145 GGGCTCTCCAGTAGGTCACCGGG + Intronic
1163815098 19:19460322-19460344 GCGCTCTGGAGGTGGGCACCTGG + Intronic
1166732088 19:45064697-45064719 GTGCTCAGAGGGAGGAAACCTGG + Intronic
1167491470 19:49795135-49795157 GTGCTCTGACGGAGGAAGCCTGG + Intronic
1167761430 19:51452325-51452347 ATGCTATGCAGTAGGTCACCAGG - Exonic
931461393 2:62453291-62453313 GTGGTCTGCAGGAGGTGTCCAGG + Intergenic
934979217 2:98826479-98826501 GTGTTCTGAAGGAAGTGAACGGG + Intronic
936997483 2:118430605-118430627 GTTCTATGAAGGAGGTCACCAGG - Intergenic
937325829 2:120989141-120989163 GCGCTCTGGACGAGGGCACCGGG + Exonic
937875319 2:126820873-126820895 GGGCTCTGCAGGAGGTCTTCAGG - Intergenic
938768882 2:134482955-134482977 GTGCTCTGCAGGGCCTCACCTGG - Intronic
940188477 2:151012913-151012935 GTTCTCTTAAAGAGGTCAGCAGG - Intronic
942322543 2:174748434-174748456 GTGGTCTAGAGGCGGTCACCAGG + Intronic
943475888 2:188354349-188354371 GTGCTCTGAAGGTTTGCACCTGG + Intronic
946860437 2:223996148-223996170 GTGCTCTGAAGACTGTCACATGG + Intronic
1169510248 20:6256003-6256025 GTGCTCTGAAGAAGGTGGCATGG + Intergenic
1169534643 20:6525221-6525243 CAGCCCTGAAGGAGGCCACCTGG - Intergenic
1171935821 20:31274208-31274230 CTGCAGTGAAGGAGGTCACCAGG - Intergenic
1172137593 20:32697672-32697694 GAGCACTGGAGGAGGTCAGCAGG + Intergenic
1172649342 20:36491982-36492004 GTGCTCTGATGGAGATTCCCAGG + Intronic
1175031892 20:55962872-55962894 GAGCTCTGAAGGATCTAACCTGG - Intergenic
1176230046 20:64027957-64027979 GTGTTCTGATGGAGGGCGCCTGG + Intronic
1178269879 21:31179651-31179673 GCGGTCTGAAGGAGGTAACGTGG + Intronic
1178764772 21:35439994-35440016 ATGCTCTGAAGGAGCTCAGTGGG - Intronic
1179516103 21:41908047-41908069 CTGCTCTGAAGGACATCACGGGG + Intronic
1184550124 22:45200017-45200039 GTGTGCTGAAGGAGGTCACCTGG + Exonic
1184675987 22:46043890-46043912 GTGCTCTGGAGGAGCTGGCCTGG + Intergenic
949169053 3:976897-976919 GAGCTCTGATGAAGGTCACCTGG - Intergenic
949270001 3:2203744-2203766 GTGCTTTCAAGGAGGTCAGAAGG - Intronic
950183725 3:10932550-10932572 GAGCTTTGAAGGAGCTTACCAGG + Intronic
950950342 3:16992253-16992275 GATCTCTTAAGAAGGTCACCTGG + Intronic
951054713 3:18134304-18134326 GAGATCTGAAGGAGTGCACCGGG - Intronic
951664719 3:25109857-25109879 GGCCTCTGAAGGAGTCCACCTGG - Intergenic
954895242 3:53969613-53969635 GTGCTCAGAAGGGGGACAACTGG + Intergenic
960723565 3:120648310-120648332 GTGCTTAGAAGGAGGGCACGCGG + Intronic
961449770 3:126997413-126997435 GTGCTCTGGGGCAGGCCACCGGG + Intronic
966239342 3:177738984-177739006 GTGCTCTAAAGGATGTTACTGGG + Intergenic
967935784 3:194726315-194726337 CTGCCCTCAAGGAGATCACCTGG - Intergenic
969304833 4:6319641-6319663 CTGCTGTGCTGGAGGTCACCCGG - Intergenic
969411597 4:7031992-7032014 GTGCTGGGAAGGAGGGCACGGGG - Exonic
976226203 4:82797526-82797548 GTGCACGGAAGGAGGGTACCAGG + Intronic
979868737 4:125789687-125789709 GTGCTGTGAAGTAGGGCCCCAGG - Intergenic
984889826 4:184482003-184482025 GTGCTCTGAAGGAAATCAACAGG + Intergenic
986150738 5:5128050-5128072 GTGCTCTGATGCAGTGCACCTGG + Intergenic
986167490 5:5287931-5287953 GTTCGCTGCAGGAGGACACCTGG + Intronic
987771463 5:22310664-22310686 GTGCTCTCAAGGTGGTCATGTGG - Intronic
990369912 5:55107234-55107256 GTGGTCTGAAGGAGGGGTCCAGG - Intronic
993669206 5:90740239-90740261 TGGCTGTGAAGGAGATCACCAGG + Intronic
993763968 5:91832573-91832595 CTGCTCTGCAGGTGGCCACCTGG - Intergenic
995884729 5:116881616-116881638 GTGCTCTGAAGGATATAAGCGGG - Intergenic
997586846 5:135048476-135048498 GAGCTGGGAAGGAGGTCTCCTGG + Intronic
998945599 5:147336388-147336410 GTGCCCTGAAGGACCTCTCCTGG - Intronic
1001038287 5:168314022-168314044 AGGCTATGCAGGAGGTCACCAGG + Intronic
1001313115 5:170625171-170625193 GGGCTCTGAAGAAGGTGAGCAGG - Intronic
1002152284 5:177244194-177244216 GTGCTATGAAGCTGGTCACCTGG + Exonic
1006419678 6:33925278-33925300 GCTCTCTGAAGGAGAACACCTGG + Intergenic
1007498874 6:42280411-42280433 GTGCTCTGAGGGAGGGCAGGGGG + Intronic
1008450797 6:51648080-51648102 TGGCTCTGAAGGAGGTCCCAGGG + Exonic
1008536686 6:52511570-52511592 GTGCTCAGAATGAGGCCAACAGG + Intronic
1012887652 6:104863774-104863796 CTGCTCTGAAGAAGGGCACTCGG - Intergenic
1013281814 6:108644828-108644850 GTGCTCTGAAGGAAAACAACAGG - Intronic
1015999464 6:139028800-139028822 GTGCACTGAAGAAGGTAACCGGG + Exonic
1016320732 6:142842878-142842900 GGGCTCTGTCTGAGGTCACCAGG - Intronic
1016720043 6:147285990-147286012 TTGCTCTGAAGAAGGTCAGCTGG - Intronic
1016723593 6:147332530-147332552 TTGCTCTGAAGCAGTACACCTGG + Intronic
1016842483 6:148538315-148538337 GTGCACTGAACCATGTCACCAGG + Intronic
1018197628 6:161368787-161368809 GTGCTTTCAAGAAGGACACCAGG + Intronic
1018782287 6:167078923-167078945 GTGCTCAGAAGGCGGAGACCTGG + Intergenic
1018910450 6:168098449-168098471 GTGGACTGAAGGAGCCCACCCGG + Intergenic
1019158913 6:170056700-170056722 TAGCTCTGAAGGAGATCTCCTGG + Intergenic
1019178878 6:170175266-170175288 GAGCACTGAGGGAGGGCACCTGG + Intergenic
1019323221 7:424970-424992 GTGCCCTGAGGGACGTCCCCTGG - Intergenic
1023921256 7:44631954-44631976 GTGCTGTGAAGGAGCCCAACAGG + Intronic
1024025046 7:45403033-45403055 GTGGTCTGAAGGAGCCCACAAGG + Intergenic
1026138362 7:67683305-67683327 GTGCTATGAAGGAAGCCCCCAGG + Intergenic
1033151458 7:138918374-138918396 ATGGTCTGAATGAGGACACCGGG + Exonic
1034453461 7:151150604-151150626 GTGTGCTGAAGGAGAACACCAGG - Intronic
1034658183 7:152745863-152745885 CTGCTTTGAAGGTGCTCACCAGG - Intergenic
1039656224 8:39411292-39411314 ATGCACTGAAGGAGGTCAAAAGG + Intergenic
1039667257 8:39547468-39547490 GTGCTCTGGAGGAAGTGACAGGG + Intergenic
1039677918 8:39690367-39690389 GTGCTCTGTTGGAGGTCCCATGG + Intronic
1041678476 8:60561457-60561479 GAGCTCTTAAGGAGGGAACCCGG + Intronic
1045897495 8:107237093-107237115 CTGCTCTTAAGTAGGGCACCGGG + Intergenic
1049615794 8:143575381-143575403 GTGCTTTGAAGGTGGACAGCAGG + Intronic
1051053812 9:12959615-12959637 GTGCTGTTTAGGAGGTCATCTGG + Intergenic
1051570730 9:18555711-18555733 GAGCTTTGAAGGAGTTAACCAGG + Intronic
1053167874 9:35857261-35857283 CTGCCCTGAAGGAGCTCACACGG + Intergenic
1056577800 9:87869279-87869301 GAGCTGGGAAGGAGGGCACCTGG - Intergenic
1059310712 9:113387338-113387360 GTGCTCTGAAGGAGGTCACCAGG - Exonic
1060221837 9:121768272-121768294 ATGCTCTGACCCAGGTCACCAGG - Intronic
1060683758 9:125589249-125589271 GCGCTCTGAAGGAGATGAACAGG - Intronic
1061514233 9:131079309-131079331 GTGCTTTGAAGCAGGGGACCTGG + Intronic
1062058891 9:134483954-134483976 GTGCCCTGGAGAAGGCCACCTGG - Intergenic
1187713302 X:22075934-22075956 AGCCTCTCAAGGAGGTCACCCGG - Intronic
1189004358 X:36980577-36980599 GTGCTCTTAAGGATGTAATCAGG - Intergenic
1189804112 X:44718396-44718418 GTGATCTCAATCAGGTCACCTGG - Intergenic
1194100374 X:89696050-89696072 GAGCTCTGAAGGAGGTGTACAGG - Intergenic
1194114978 X:89885369-89885391 GTGCACTGAAGGAGAACACCAGG - Intergenic
1195923684 X:110004744-110004766 GAGTTCTGAAGCAGGTCCCCAGG + Intronic
1196619831 X:117808779-117808801 GTGCTCTGATGGAGGTGGCAGGG - Intergenic
1198299322 X:135319427-135319449 GAGCTCTGAAGTATGTCATCTGG + Intronic
1198438187 X:136637016-136637038 GTGCTCTGCAGAAGGTAAGCAGG - Intergenic
1200453378 Y:3357412-3357434 GAGCTCTGAAGGAGGTGTACAGG - Intergenic
1200467767 Y:3542460-3542482 GTGCACTGAAGGAGAACACCAGG - Intergenic