ID: 1059312060

View in Genome Browser
Species Human (GRCh38)
Location 9:113395341-113395363
Sequence CTGGACAAGACAGCCTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059312060_1059312063 9 Left 1059312060 9:113395341-113395363 CCCACTGAGGCTGTCTTGTCCAG 0: 1
1: 0
2: 0
3: 12
4: 171
Right 1059312063 9:113395373-113395395 TCTCTTATGTAAGTTATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059312060 Original CRISPR CTGGACAAGACAGCCTCAGT GGG (reversed) Intronic
900655634 1:3755462-3755484 CCGGACAAATCGGCCTCAGTGGG - Exonic
900755204 1:4429740-4429762 CTGTAGAAGAGAGCCTGAGTTGG + Intergenic
901801922 1:11713256-11713278 TTGGGCAAGACAGCCTCTCTGGG - Intronic
904840136 1:33367346-33367368 CTGGGCAGGACAGGCTGAGTGGG + Exonic
908764848 1:67545549-67545571 CTTGGCAAGGCAGCCTCAGGGGG - Intergenic
912661192 1:111532471-111532493 CTGGAAAAGGCAGCCTCTGAAGG - Intronic
914870579 1:151470528-151470550 CTGGAGGAGGCAGCCTTAGTAGG - Intergenic
915521647 1:156448684-156448706 CGGGAGAAGACAGCCTCAGGCGG + Intergenic
918400296 1:184156257-184156279 GGGGACAAGACAGCCTTTGTGGG - Intergenic
919807978 1:201392050-201392072 GTGGAGGAGACAGGCTCAGTGGG - Intronic
920315087 1:205071158-205071180 CTGGACAGGCCAGCCTGAATGGG - Intronic
920555849 1:206903902-206903924 CTGTACAACACAGTCTCACTGGG - Intronic
922109230 1:222541300-222541322 CTAGGCAAGACAGCATCACTGGG + Intronic
922309597 1:224375725-224375747 CTGGACAAACCAGGCTCTGTAGG + Intronic
924670599 1:246120475-246120497 CTGAAGAGGAGAGCCTCAGTAGG - Intronic
1066177489 10:32924139-32924161 GGGGACAAGACAGCAGCAGTGGG - Intronic
1067765580 10:49083383-49083405 CTGGACGAGAGAGCTACAGTAGG - Intronic
1070594335 10:77821665-77821687 CTGGACAAGGCAGACTCTGAAGG - Exonic
1070791779 10:79193912-79193934 CTGCACATGTCAGCATCAGTTGG - Intronic
1070940117 10:80337180-80337202 CTGGACAAGTCTTCCTCAGGAGG - Intronic
1070967962 10:80541244-80541266 ATGGACAAGTCACCCTGAGTGGG + Intronic
1071345097 10:84684933-84684955 CAGGAGGAGACAGCCTCAATGGG - Intergenic
1073035834 10:100563647-100563669 CTGGGGAAGACAGCATCAGATGG - Intergenic
1074223256 10:111459254-111459276 CTGGACAAAAGAGTCCCAGTTGG - Intergenic
1074904909 10:117853039-117853061 GTGGACAGGACAGCCTGGGTAGG + Intergenic
1076078972 10:127560748-127560770 CTGGAGAAGACAGCCTGCGGGGG + Intergenic
1076404215 10:130201539-130201561 CTGGGTAAGACAGGCCCAGTGGG + Intergenic
1076576487 10:131473367-131473389 TGGGACAGAACAGCCTCAGTGGG + Intergenic
1080264083 11:30382944-30382966 CCGAACATGACAGCTTCAGTTGG - Intergenic
1080279823 11:30544234-30544256 CTGGACAATACATCTCCAGTGGG - Intronic
1080795575 11:35559999-35560021 GTGGACAAGAAAGCCTCATTGGG + Intergenic
1084287352 11:68140836-68140858 CTCAACAAGACCCCCTCAGTGGG + Intergenic
1084558018 11:69886547-69886569 CTGGACAGGACAGCCGGGGTGGG + Intergenic
1085508013 11:77071147-77071169 CTGGGGAAGCCAGCCTCGGTGGG - Intronic
1086018495 11:82196442-82196464 CTGGCCAAAACAGGCTCAATGGG + Intergenic
1091288112 11:134420145-134420167 CAGGACATGACAGCATCAGGGGG + Intergenic
1095714420 12:45326764-45326786 CTGAATAAGACAGCTTCAGAAGG - Intronic
1098504774 12:71236922-71236944 CTGAACCAGACAGCCTGAGTTGG - Intronic
1102471865 12:113163837-113163859 CACGACATGACACCCTCAGTGGG - Intronic
1102766403 12:115437209-115437231 GTGCATCAGACAGCCTCAGTGGG + Intergenic
1105036135 12:132922925-132922947 CTCTAGAAGACAGCCTCAGGGGG + Exonic
1107926329 13:45265902-45265924 CTGGTGAAGAAAGCATCAGTAGG - Intronic
1109313641 13:60724471-60724493 CTGGAAGAAACAGCCTCAGGAGG + Intergenic
1113557882 13:111253080-111253102 TGGGACAAGAAAGCCTTAGTGGG + Intronic
1113611367 13:111646911-111646933 TTGGAAAAAACGGCCTCAGTTGG + Intronic
1115904379 14:38190426-38190448 TTGCCCAAGACAGCCTCAGGAGG - Intergenic
1115988962 14:39131802-39131824 ATAGACAAGAAAGCCTCATTTGG - Intronic
1117310694 14:54519645-54519667 CTGGAGAAGACAGCCTATGCTGG + Intronic
1118001507 14:61527573-61527595 CTGGACAAGAAAAGATCAGTTGG - Intronic
1119411193 14:74431767-74431789 CTGGACATGCCACCCTCAGATGG + Intergenic
1123115227 14:105891436-105891458 CTGGGCAGGTCAGCCTCAATGGG + Intergenic
1123117401 14:105900877-105900899 CTGGGCAGGTCAGCCTCAATGGG + Intergenic
1123119491 14:105910145-105910167 CTGGGCAGGTCAGCCTCAATGGG + Intergenic
1123932188 15:25177304-25177326 CTGGAGAACACATCCCCAGTTGG - Intergenic
1124204438 15:27704871-27704893 CAGGACAAGACAGCCCCTGGTGG + Intergenic
1124291555 15:28456912-28456934 CAGGACGAGACAGCCCCAGCGGG + Intergenic
1127454848 15:59147696-59147718 CTAGACATGAGAGCCTCATTTGG - Intronic
1130561699 15:84964012-84964034 CTAGAGAAGACAGCCACATTGGG - Intergenic
1131063673 15:89419601-89419623 CTGAACAAGTGAGCCTCTGTCGG - Intergenic
1131383897 15:91986680-91986702 CTGGACAGGGCAGCCCCAGAGGG + Intronic
1131420962 15:92305020-92305042 CTGCTGGAGACAGCCTCAGTGGG - Intergenic
1134201439 16:12202882-12202904 GTGGACAAGACTGGCTCATTAGG + Intronic
1134214215 16:12303917-12303939 ATGGGCAAGACAGGCTCAGCTGG - Intronic
1134785838 16:16942545-16942567 CATGACAACTCAGCCTCAGTAGG + Intergenic
1136055006 16:27681813-27681835 CTGGAGAAGTCACCCTCACTTGG + Intronic
1136707223 16:32200751-32200773 CAGGACGAGACAGCCCCAGCGGG - Intergenic
1136760687 16:32728666-32728688 CAGGACGAGACAGCCCCAGCGGG + Intergenic
1136807416 16:33141720-33141742 CAGGACGAGACAGCCCCAGCGGG - Intergenic
1137834934 16:51582994-51583016 CCGGACAAGAAAGTCTCAGCTGG + Intergenic
1140173715 16:72634080-72634102 CTGGCCAAGACAGAGTCAGTAGG + Intergenic
1142088215 16:88195849-88195871 CTGGTCAGGACAGCCTCTGTGGG + Intergenic
1203062839 16_KI270728v1_random:988980-989002 CAGGACGAGACAGCCCCAGCGGG + Intergenic
1144304366 17:13954398-13954420 CTAGACTAGACAGCCCCTGTGGG + Intergenic
1144595148 17:16563469-16563491 CTGGGCAAGGCAGCATCAGGTGG + Intronic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1149447461 17:56724710-56724732 TTGGACAAGTCAGACTCGGTTGG + Intergenic
1150488070 17:65557866-65557888 CTGGACAAGCCAACCACGGTTGG + Exonic
1152029471 17:77832920-77832942 CTGGAGAAGACAAACTCAGGAGG + Intergenic
1157188310 18:45559459-45559481 TTGTACAAGACAGCCAAAGTAGG + Intronic
1162162851 19:8731577-8731599 CTGCACAGGAGAGCTTCAGTAGG - Exonic
1162218571 19:9157076-9157098 CAGGACAAGATGGCCTCAATGGG + Intronic
1162496302 19:11025047-11025069 CTGGGCAAGAGGGCCTCAGCCGG - Intronic
1162931776 19:13961130-13961152 CTGGGCAGGGCAGCCTCTGTTGG + Exonic
1165074931 19:33275423-33275445 CTGGAGAAGGCAGCCCCTGTGGG - Intergenic
1166992216 19:46699367-46699389 CTGGAGCTGACTGCCTCAGTGGG - Intronic
1167451710 19:49574225-49574247 CTTGACAAACCAGCCTCAGGGGG + Intronic
1168088841 19:54068393-54068415 ATGGACAAGACAGTCTCACATGG + Intergenic
925059732 2:881592-881614 CTGGAGAGGGCAGCCTCTGTGGG - Intergenic
925360814 2:3278821-3278843 CTGCACAGGGCAGCCTCTGTGGG - Intronic
926706845 2:15843246-15843268 CGGGACCAGACAGCCGCTGTGGG + Intergenic
926904878 2:17796309-17796331 CTTGAGAGGCCAGCCTCAGTGGG - Intronic
927104339 2:19810809-19810831 CTGGACAACACAGCCCCTGTTGG + Intergenic
927375394 2:22407398-22407420 ATGGACAAGACAGCGTTTGTCGG + Intergenic
929302047 2:40316086-40316108 GTCGACAAGACAACCTCTGTGGG + Intronic
930749017 2:54914644-54914666 TTGGCCAAGAAAGCATCAGTTGG - Intronic
933840678 2:86283734-86283756 TTGGACAAGGCAGTCTAAGTGGG - Intronic
935124048 2:100207418-100207440 CTGCACAAGACAGCCCCATGAGG - Intergenic
937262982 2:120598197-120598219 CAGGCCAAGACAGACGCAGTGGG - Intergenic
938392091 2:130914721-130914743 CTGGACAACACAGCCCCTCTGGG + Intronic
938700307 2:133872176-133872198 GTGGACTAGACTGCCTTAGTAGG - Intergenic
946650055 2:221883596-221883618 CTTCAGAAGACAGCCTCTGTGGG + Intergenic
947768895 2:232655345-232655367 CTGGTCAAGTCAGCCTTAGAAGG - Intronic
948709297 2:239815660-239815682 CTGGGCAACACAGCGTCGGTGGG + Intergenic
948965509 2:241376558-241376580 CGGGACAAGCCTGCCTCTGTGGG - Intronic
949046318 2:241874104-241874126 CGTGACAAGCCAGTCTCAGTGGG - Intergenic
1169824029 20:9746316-9746338 CTGGACAAGAAAGCCTGGGCAGG - Intronic
1179406553 21:41131230-41131252 CTGGAGGAGAAAGCCTCAGGGGG + Intergenic
1179977944 21:44881300-44881322 CAGGACCAGACAGCCACAGTGGG + Intergenic
1180035610 21:45246687-45246709 GTGGAGAGGACAGCCTCAGCCGG + Intergenic
1180737128 22:18025409-18025431 TTGGACAACACAGCTTCAGATGG - Intergenic
1181712819 22:24701533-24701555 CTGGACAACACAGCCTGATGTGG - Intergenic
950126864 3:10514914-10514936 TTGGGCAAGACAGCCGCAGTGGG + Intronic
950425047 3:12920659-12920681 CGGCACATGACAGCCTCAGCGGG - Intronic
952192026 3:31033937-31033959 CTGGACAACTCACCCTCAGAAGG + Intergenic
953985625 3:47440307-47440329 CTGGACAGAAAAGCTTCAGTGGG + Intronic
955649699 3:61180537-61180559 CTGGAGAAGAGAGACTGAGTTGG - Intronic
955763031 3:62309801-62309823 GTGGACAGGAAAGCCTCACTCGG + Intergenic
960988693 3:123296555-123296577 CTGGACAAGACAGGGGCAGTGGG + Intronic
962499329 3:135973970-135973992 CTTGACAAGAGTGCTTCAGTGGG - Intronic
963012537 3:140785892-140785914 CAGGACAAGAAAGCTTCAATGGG - Intergenic
964059023 3:152498412-152498434 CTGGACAAGACAGCAGAAGTAGG + Intergenic
966931509 3:184678619-184678641 CTGGTCAGGACGGCTTCAGTGGG + Intronic
968652335 4:1765195-1765217 AGGGACAAGGCAGCCCCAGTGGG - Intergenic
968758576 4:2429174-2429196 CAGGCCAAGACAGCATCAGGGGG - Intronic
973338309 4:48978650-48978672 GTGGCCAAGACAACCTCAATGGG - Intergenic
977857028 4:101906853-101906875 CTTGCCAAGACCACCTCAGTTGG + Intronic
984696792 4:182787269-182787291 ATGGACAAAACAGACTCAGAGGG + Intronic
988399813 5:30748466-30748488 CAGGAAAACACAGACTCAGTGGG - Intergenic
990039828 5:51365609-51365631 CTGGAAAATACAGCCAAAGTGGG + Intergenic
990939777 5:61189723-61189745 TTGAACAACACAGACTCAGTTGG - Intergenic
992936228 5:81708731-81708753 CTGAAAAAGACAGCTTCAATTGG - Intronic
996739042 5:126782326-126782348 CTGGATATGACACCCCCAGTGGG + Intronic
996855059 5:127996565-127996587 TGGGACAAGACAGCTTCTGTTGG + Intergenic
999231076 5:150062101-150062123 TTGGACAAGACAACCTCTGAGGG + Intronic
999448293 5:151659027-151659049 CTGGACTAGATGGCCTCTGTGGG + Intergenic
1001080055 5:168660968-168660990 CTGGGCAAGACAGCATGAGAGGG - Intergenic
1005911110 6:30310379-30310401 CTCAACAAGACAGCCACAGGAGG + Intergenic
1010255404 6:73751454-73751476 CTGATCAAAACAGCCTTAGTAGG - Intronic
1013102414 6:106998105-106998127 ATGGGCAAGCCAGCCTCAGCAGG + Intergenic
1014713154 6:124832868-124832890 CTTGACAACAAAGCCTCATTAGG + Intergenic
1014800899 6:125776958-125776980 ATGTACAAGACAGCTTCACTTGG + Intergenic
1015217315 6:130765268-130765290 CTGGAGAAAACAGCCTTATTTGG + Intergenic
1015311953 6:131776122-131776144 GTGGACAAGACAGGCTTAGGAGG + Intergenic
1019550213 7:1598483-1598505 CTGGCCAGGGCAGGCTCAGTGGG + Intergenic
1019934563 7:4245870-4245892 TAGGACAAGACAGCCTGAGGGGG - Intronic
1019993346 7:4707594-4707616 CTGGAGAAGGCTGCCTCACTGGG + Intronic
1021897524 7:25250997-25251019 TTTGACAAGACAGGCTCACTGGG - Intergenic
1022207425 7:28179166-28179188 CTGGATTAGACAGCCCCATTGGG + Intronic
1023589712 7:41768504-41768526 CTGGCTAAGTCAGCCTCATTCGG - Intergenic
1029767014 7:102632068-102632090 CTGGAGAAGCCAGCCTCACATGG + Intronic
1030519904 7:110586140-110586162 CTTGACAAGACAGCATGACTTGG - Intergenic
1031547296 7:123066770-123066792 CTGGATAAGAAAGTCTTAGTTGG + Intergenic
1031940196 7:127780480-127780502 TTGGACAAGTTAGCCTCACTGGG - Intronic
1032284549 7:130530825-130530847 CTGGGCAGGACAGCCACAGGTGG + Intronic
1032543033 7:132720035-132720057 CTGGACAAGGCAGCCGATGTGGG + Intronic
1033285024 7:140033974-140033996 CTGGAGAAGACAGACTCTGAAGG - Intronic
1035186834 7:157132945-157132967 CTGGAAAAGCCAGTCTCAGAAGG - Intergenic
1036228104 8:6976965-6976987 CTGGAAAATACAGCTTCAGAGGG - Intergenic
1036229394 8:6986514-6986536 CTGGAAAATACAGCTTCAGAGGG - Intergenic
1036230557 8:6996082-6996104 CTGGAAAATACAGCTTCAGAGGG - Intergenic
1036231845 8:7005617-7005639 CTGGAAAATACAGCTTCAGAGGG - Intronic
1036233006 8:7015185-7015207 CTGGAAAATACAGCTTCAGAGGG - Intronic
1038415341 8:27390851-27390873 CTGGACAAGATAATCTCTGTAGG - Intronic
1042220640 8:66470060-66470082 TTGGGCAAGAAAACCTCAGTGGG - Intronic
1053187809 9:36033731-36033753 CTGGACACGACAGAAACAGTAGG + Intergenic
1053306685 9:36989265-36989287 CTGGAGAACACAGCCTCATACGG + Intronic
1055148654 9:72967382-72967404 CTGGAAAAGACATTCTAAGTTGG + Intronic
1057016549 9:91657531-91657553 CAGGACCAAACAGCCTGAGTTGG - Intronic
1058779613 9:108319640-108319662 CTGGAAAAGTCACCCTCTGTCGG - Intergenic
1059012720 9:110479767-110479789 TTGGACAAAACAGCTTCAGTTGG + Intronic
1059312060 9:113395341-113395363 CTGGACAAGACAGCCTCAGTGGG - Intronic
1060898610 9:127237712-127237734 ATGGGCAATCCAGCCTCAGTTGG + Intronic
1061159436 9:128884721-128884743 TTGGACCACCCAGCCTCAGTGGG + Intronic
1061164604 9:128915004-128915026 CTGGACAAGTCAGCGTCTTTGGG + Intronic
1061492149 9:130951325-130951347 CTGGGCAAGACAGGGTCAGTGGG - Intergenic
1061687659 9:132295430-132295452 CAGGGCAAGAGAGCCTCAGATGG - Intronic
1062094836 9:134697758-134697780 CTGGAGATGACAGCCTTAGCTGG - Intronic
1062710873 9:137974578-137974600 CAGGTCCAGACAGCCTCGGTCGG - Intronic
1188595213 X:31891950-31891972 ATGGACAAGACAGCATCCTTTGG + Intronic
1192121568 X:68461138-68461160 CTGGACAGGACACCCTCAACTGG - Intergenic
1192179777 X:68909233-68909255 CAGGACAAGTCAGGCTGAGTGGG - Intergenic
1194932525 X:99904771-99904793 GGGGACTAGACAGCCTCTGTAGG - Intergenic
1201250367 Y:12051619-12051641 CTAGAATAGACAGCCACAGTAGG + Intergenic
1201574917 Y:15452801-15452823 CTGGACAGGAAAGATTCAGTTGG - Intergenic