ID: 1059314138

View in Genome Browser
Species Human (GRCh38)
Location 9:113410071-113410093
Sequence GCACGAAGACGCTGGCGGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 40}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059314133_1059314138 2 Left 1059314133 9:113410046-113410068 CCCGCTCACCAGGATGTGGCGTA 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1059314138 9:113410071-113410093 GCACGAAGACGCTGGCGGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 40
1059314125_1059314138 26 Left 1059314125 9:113410022-113410044 CCCGCGCCTCCCTTATGCCTCTG 0: 1
1: 0
2: 1
3: 22
4: 228
Right 1059314138 9:113410071-113410093 GCACGAAGACGCTGGCGGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 40
1059314124_1059314138 27 Left 1059314124 9:113410021-113410043 CCCCGCGCCTCCCTTATGCCTCT 0: 1
1: 0
2: 0
3: 5
4: 158
Right 1059314138 9:113410071-113410093 GCACGAAGACGCTGGCGGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 40
1059314128_1059314138 17 Left 1059314128 9:113410031-113410053 CCCTTATGCCTCTGTCCCGCTCA 0: 1
1: 0
2: 0
3: 14
4: 144
Right 1059314138 9:113410071-113410093 GCACGAAGACGCTGGCGGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 40
1059314135_1059314138 -6 Left 1059314135 9:113410054-113410076 CCAGGATGTGGCGTACAGCACGA 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1059314138 9:113410071-113410093 GCACGAAGACGCTGGCGGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 40
1059314131_1059314138 9 Left 1059314131 9:113410039-113410061 CCTCTGTCCCGCTCACCAGGATG 0: 1
1: 0
2: 1
3: 8
4: 145
Right 1059314138 9:113410071-113410093 GCACGAAGACGCTGGCGGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 40
1059314126_1059314138 25 Left 1059314126 9:113410023-113410045 CCGCGCCTCCCTTATGCCTCTGT 0: 1
1: 0
2: 0
3: 19
4: 264
Right 1059314138 9:113410071-113410093 GCACGAAGACGCTGGCGGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 40
1059314127_1059314138 20 Left 1059314127 9:113410028-113410050 CCTCCCTTATGCCTCTGTCCCGC 0: 1
1: 0
2: 2
3: 8
4: 175
Right 1059314138 9:113410071-113410093 GCACGAAGACGCTGGCGGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 40
1059314134_1059314138 1 Left 1059314134 9:113410047-113410069 CCGCTCACCAGGATGTGGCGTAC 0: 1
1: 0
2: 0
3: 9
4: 57
Right 1059314138 9:113410071-113410093 GCACGAAGACGCTGGCGGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 40
1059314129_1059314138 16 Left 1059314129 9:113410032-113410054 CCTTATGCCTCTGTCCCGCTCAC 0: 1
1: 0
2: 0
3: 13
4: 181
Right 1059314138 9:113410071-113410093 GCACGAAGACGCTGGCGGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059314138 Original CRISPR GCACGAAGACGCTGGCGGCG CGG Exonic