ID: 1059320521

View in Genome Browser
Species Human (GRCh38)
Location 9:113464844-113464866
Sequence CAGAAGAGCCAGGAACCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 352}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059320521_1059320525 9 Left 1059320521 9:113464844-113464866 CCCTGGGGTTCCTGGCTCTTCTG 0: 1
1: 0
2: 2
3: 31
4: 352
Right 1059320525 9:113464876-113464898 TTACTCCTGCTCAACATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059320521 Original CRISPR CAGAAGAGCCAGGAACCCCA GGG (reversed) Intronic
900460905 1:2801757-2801779 CAGGACAGCCAGGAGACCCAAGG - Intergenic
900590229 1:3456145-3456167 CCGAAGAGCCAGCGACCTCAGGG - Intronic
900869687 1:5293135-5293157 GAGAAGAGCCAGAACCCCCAAGG - Intergenic
900874931 1:5335393-5335415 CAGAAGAGACAGGAACACTCAGG - Intergenic
902224579 1:14988561-14988583 GAGAAAAGCCAGTAACCCCGGGG + Intronic
902336396 1:15757383-15757405 CACAAGAGCCATGAGCACCAGGG - Intronic
902614934 1:17618559-17618581 AAGAAGCGGCAGCAACCCCAAGG - Intronic
903521589 1:23954842-23954864 CAAACTAGCAAGGAACCCCATGG + Intergenic
903678282 1:25080279-25080301 CAGAGGAGCCAGAAAGGCCAAGG + Intergenic
903950354 1:26993031-26993053 CAGAGGAGCCCCGGACCCCACGG - Intergenic
904358908 1:29959824-29959846 CAGCAGAGCCACTAACCCCCTGG - Intergenic
904406153 1:30289613-30289635 CAGAAGAAACAAGAAACCCAAGG + Intergenic
904625861 1:31801739-31801761 CAGAGGACCCAGCCACCCCATGG + Intronic
905134335 1:35786897-35786919 CAGAAGTACCAAGAACTCCAAGG + Intergenic
905166261 1:36084888-36084910 CAGAAGGGTCAGAAACCCCTAGG - Exonic
905168699 1:36098135-36098157 CAGGGGAGCCAGGGACCCCTGGG + Exonic
905457367 1:38097387-38097409 GAGAAGAGGCAGGAACCCCCAGG - Intergenic
906206708 1:43991082-43991104 GAGAGGAGGCAGGAGCCCCAGGG + Exonic
906536786 1:46555164-46555186 CAGCAGAGCCAGGACTTCCAAGG + Intergenic
907816610 1:57924209-57924231 CAGATGAGCCATGCACCTCAAGG + Intronic
907848187 1:58228702-58228724 CAGAAGGTCCAAGAACCCCAGGG - Intronic
911159736 1:94672332-94672354 GAGAAGAGCCAGGGACCCCCAGG + Intergenic
912624028 1:111193102-111193124 AAGAAGAGCCATGAAAGCCAGGG - Intronic
912955265 1:114151289-114151311 CACAAGTCCCAGGAAGCCCAGGG - Intronic
913141385 1:115944676-115944698 CAGAAAATCCAGGAAGCCCCAGG - Intergenic
913182350 1:116334308-116334330 AAGAGAAGCCAGGAACCCCTGGG - Intergenic
914857317 1:151362314-151362336 CAGGAGGGCTAGGAACACCATGG - Intergenic
914913209 1:151802772-151802794 AAGAAGGGCCAGGAAGTCCAGGG - Intronic
916322236 1:163517658-163517680 AAGAAAAGCCAGGGACCCAATGG + Intergenic
918235458 1:182575844-182575866 CAGAAGAGCCCTGAACTGCAAGG + Intronic
918407149 1:184222553-184222575 CAGAAGAACTAGGGAACCCAGGG - Intergenic
918897016 1:190361306-190361328 ATCAGGAGCCAGGAACCCCATGG + Intronic
919269626 1:195322874-195322896 AAGAAAAGCCAGGGACCCAATGG - Intergenic
919972987 1:202592756-202592778 CCAAGGGGCCAGGAACCCCAAGG - Exonic
920097476 1:203496004-203496026 CAGGAAAGCCAGGAGCCTCATGG - Exonic
924791294 1:247251229-247251251 AAGAAAAGCCTGGAACCCAATGG - Intergenic
1063573615 10:7240683-7240705 CAGATGAGACAGAAATCCCAAGG - Intronic
1063865090 10:10355416-10355438 GAGAAGAGCCAGGTATCACAAGG - Intergenic
1063912021 10:10839692-10839714 CATAAGGTCCAGGAATCCCAGGG - Intergenic
1064451326 10:15444712-15444734 CAGAAGAGCCTGGAAGTCTAGGG + Intergenic
1068417298 10:56740431-56740453 CAGTAGAGCCTGGAACAACATGG + Intergenic
1070647605 10:78212519-78212541 CAGCAGAGCCAGGAAACACTAGG - Intergenic
1071017036 10:81009739-81009761 CAGAAGAGCGAAGAAGCCCTGGG + Intergenic
1071291674 10:84193696-84193718 CAGGAGAACGAGGAAGCCCAAGG + Intergenic
1071410338 10:85385708-85385730 CAAAAGAGCCTGGAACCTGAGGG + Intergenic
1072190608 10:93073933-93073955 CAGCAGCGCCGGGAGCCCCATGG - Exonic
1073967847 10:109012339-109012361 CTGGAGACCCAGGAAACCCAGGG + Intergenic
1074498436 10:114000632-114000654 CGGAAGAGCTAGTAACCTCAGGG - Intergenic
1075485550 10:122819333-122819355 CAGAGGAGCCAGGGACACCCTGG - Intergenic
1076321176 10:129582748-129582770 CTAAAGAGCCAGGAACCCGCTGG - Intronic
1076679202 10:132163040-132163062 CAGAAGGACCAGGGGCCCCACGG - Intronic
1076788411 10:132763278-132763300 CTGCAGAGCCAAGAACCGCATGG + Intronic
1076941906 10:133615658-133615680 GAGAAAAGCCATGAACACCAGGG - Intergenic
1077305008 11:1865042-1865064 CAGGAGAGGCAGGAAAGCCAAGG + Intronic
1079330218 11:19526953-19526975 CCAAGGAGCCATGAACCCCAGGG - Intronic
1080936529 11:36869536-36869558 CAGAAGACCCAGGAAGCCAGTGG - Intergenic
1080953504 11:37064981-37065003 CAGAAGGGCCAGGAAACCAAAGG + Intergenic
1081709871 11:45209708-45209730 CAGCAGAGCCTGAAACCCCGCGG - Intronic
1081806383 11:45893092-45893114 CAGCACAGCCAGGAACACAAAGG + Intronic
1082111257 11:48277424-48277446 AAGAAAAGCCTGGGACCCCATGG - Intergenic
1083372295 11:62191965-62191987 CAGACCAGACAGGAACCCCAGGG - Intronic
1083795450 11:65014206-65014228 CAGAATGGTCAGGAGCCCCATGG - Exonic
1084183762 11:67459541-67459563 CTAAAGAGCCTGGAACTCCAGGG + Exonic
1084356067 11:68639500-68639522 CAGTGCAGCCTGGAACCCCAGGG - Intergenic
1084546680 11:69818344-69818366 CAGCAGAGCCTGGAGCCCCGGGG + Intronic
1084648046 11:70472212-70472234 CAGCACTGCCAGGAACCTCATGG + Intronic
1084944419 11:72631099-72631121 CAAAGGAGCCAGGACCCCCAGGG - Intronic
1086491881 11:87363915-87363937 AAGGAGAGCCAGGGGCCCCACGG - Intergenic
1087380179 11:97395604-97395626 AAGAAAAGCCTGGAACCCTATGG - Intergenic
1087961863 11:104361836-104361858 CAGAAGACACAGGAAACACATGG - Intergenic
1088267481 11:108001593-108001615 TAGAAGAGGCAGGGAACCCAGGG - Intergenic
1094125725 12:27020852-27020874 CTGAAGAACCAGGAAAACCAAGG + Intergenic
1095751333 12:45714765-45714787 CAGATGAGGCAGGAAACCTATGG + Intergenic
1097029838 12:56082411-56082433 CAGAGGAGCTGGGAACTCCAGGG - Intronic
1097568889 12:61307192-61307214 AAGAAGAGCCTGGGACCCGATGG - Intergenic
1098886539 12:75966424-75966446 CAGAAGAGGCAGGACAGCCAAGG + Intergenic
1104122118 12:125809446-125809468 CAGCAGAGCCATGAACAGCAAGG - Intergenic
1104449153 12:128855005-128855027 CAACAGAGCCAGGAACACAAAGG - Intronic
1105325611 13:19368185-19368207 CTGTAGAGCCAGGAAGCCCAGGG + Intergenic
1105829718 13:24153246-24153268 CAGAGGTGCCAGGACCACCAGGG - Intronic
1105867893 13:24476989-24477011 CTGTAGAGCCAGGAAGCCCAGGG - Intronic
1106655726 13:31744025-31744047 AAGAAGATCCAGGAAGCCCCTGG - Intronic
1106835311 13:33627826-33627848 CAGAAAAGGCAGGAGCCCCACGG - Intergenic
1107350222 13:39506431-39506453 CAGAAGAGCGTGAAATCCCATGG - Intronic
1107879464 13:44820520-44820542 CAGAAGATCCAGCTCCCCCAGGG - Intergenic
1112172854 13:96992533-96992555 CAGCACACCCAGGAACCTCACGG + Exonic
1112401049 13:99078580-99078602 CAGTAGAGCCAAGAAGCCCCAGG + Intronic
1112702708 13:102030343-102030365 AAGATGAGGCAGGGACCCCACGG + Intronic
1113301335 13:109025066-109025088 CAATAAAGCCAAGAACCCCAGGG - Intronic
1113457207 13:110457386-110457408 CAGGGGAGCCGGGAAGCCCAGGG - Exonic
1113464272 13:110503190-110503212 CAGGAGCTCCAGGAACCCCAGGG + Exonic
1113995001 14:16057660-16057682 CAGAACAGCTGGGCACCCCAAGG - Intergenic
1114537257 14:23430796-23430818 CAGCAGTGCCATGAAACCCAGGG + Intronic
1115381231 14:32741992-32742014 AAGAAAAGCCAGGGACCCGATGG - Intronic
1116802591 14:49458836-49458858 CAGCCAAGCCAGGAACACCAAGG - Intergenic
1117072581 14:52069542-52069564 CAGGAGCGCCCGGGACCCCAGGG - Intergenic
1117633647 14:57720450-57720472 AAGAAAAGCCTGGAACCCAATGG - Intronic
1118491931 14:66269469-66269491 CAGATGAGACAGGATCTCCATGG + Intergenic
1118747154 14:68782567-68782589 CAGTAGATCCAGCCACCCCAAGG - Intergenic
1119765569 14:77185492-77185514 CAGAAGAGCAAGTGACCCTAAGG + Intronic
1121109216 14:91300992-91301014 GAGAAAGGCCAGAAACCCCAGGG - Intronic
1121920439 14:97875962-97875984 CAGAAGAGTCAGGCACCTGAAGG - Intergenic
1122984349 14:105205418-105205440 CACAGGACCAAGGAACCCCAAGG - Intergenic
1124456048 15:29843893-29843915 CAGAAGGGACAGTAACCACAAGG + Intronic
1124668378 15:31614367-31614389 CAGAAGTGGTATGAACCCCAAGG + Intronic
1126065968 15:44826721-44826743 CAGTGGAACCAGGAAACCCAAGG + Intergenic
1126093867 15:45073845-45073867 CAGTGGAACCAGGAAACCCAAGG - Exonic
1127257908 15:57307041-57307063 AGGAAGAGCCAAGGACCCCAAGG + Intergenic
1127918779 15:63476790-63476812 CTGAAGAGACAGTATCCCCATGG - Intergenic
1128601468 15:68998760-68998782 CGGAACAGACAGGACCCCCATGG + Intronic
1129722855 15:77887558-77887580 CAGCAGGGCCAGGTAGCCCAAGG - Intergenic
1130102156 15:80902305-80902327 CAGAAGAGCCATGAGCACCTGGG - Intronic
1131388062 15:92024008-92024030 CAGAGGAACCAGGGACCACATGG - Intronic
1131440307 15:92454729-92454751 CAGCAGAGCCAGGGGCCCCTGGG - Intronic
1132540331 16:505460-505482 CAGAAGGGCCTGCACCCCCAAGG - Intronic
1132605644 16:792684-792706 CGGCAGGGCCAGGGACCCCAGGG - Intronic
1132695744 16:1201034-1201056 CTGAAGAGCCAGGAACACCCTGG + Intronic
1134231817 16:12435767-12435789 CAGCAGAGCCAGCCACTCCATGG + Intronic
1134236105 16:12467858-12467880 CAGTTGAGCCAGAAACCTCACGG + Intronic
1134355744 16:13480501-13480523 TAGATGTGCCAGGAACCTCAAGG - Intergenic
1134369912 16:13613635-13613657 CAGAAGACCCAGAAAGCCCATGG + Intergenic
1135611733 16:23873467-23873489 AAGAAGAACCAGAAAACCCATGG - Intronic
1135889072 16:26341183-26341205 CAGAAAAGAAAGGAAACCCAGGG - Intergenic
1136570034 16:31091153-31091175 CGGAAGGTCCAAGAACCCCAGGG - Exonic
1136867482 16:33769155-33769177 GAGAGGAGCCTGGAGCCCCAAGG + Intergenic
1137021806 16:35435566-35435588 CAGAAGAGCCCAGAAGCCTAAGG - Intergenic
1138231162 16:55337456-55337478 AAGAAGAGCCAGAGACACCAGGG - Intergenic
1138979185 16:62245537-62245559 CAGAAGAGACAGGAATGCAAAGG + Intergenic
1139526143 16:67518100-67518122 GAGAAGAGCCAGGAGTCCCTCGG + Intergenic
1141675270 16:85514288-85514310 GAGAAGGGCCAGGAACCCCCAGG + Intergenic
1141687097 16:85576796-85576818 CAGAAGCACCATGATCCCCAAGG - Intergenic
1141773668 16:86107254-86107276 CAGATGAGCTGGGAACCCCTGGG - Intergenic
1141997355 16:87644060-87644082 CACGACAGCCAGGAACCCCTGGG - Intronic
1142292745 16:89200394-89200416 AAGAAGACCCAGGAACCGGAAGG - Intronic
1203104676 16_KI270728v1_random:1347048-1347070 GAGAGGAGCCTGGAGCCCCAAGG - Intergenic
1203128838 16_KI270728v1_random:1615320-1615342 GAGAGGAGCCTGGAGCCCCAAGG + Intergenic
1142583652 17:957284-957306 CACAGAAGCCAGGAACCCCCCGG + Intronic
1142903324 17:3026708-3026730 CACTCCAGCCAGGAACCCCAAGG - Intronic
1143071884 17:4302363-4302385 CAGAAGACACAGCAACCCAAGGG - Intronic
1143294306 17:5859358-5859380 GAGGAGGTCCAGGAACCCCAGGG - Intronic
1143526895 17:7478351-7478373 GAGAGGAGCGAGGAACCCCGGGG - Intronic
1144156906 17:12513305-12513327 CAGAAGAGCCACTAAAACCAGGG + Intergenic
1144297087 17:13886358-13886380 CAGAAGAGCCATAAATCTCAGGG + Intergenic
1147045132 17:37745856-37745878 CAGGAGAGTGAGGAGCCCCAGGG - Intergenic
1147253004 17:39164973-39164995 CAGAGGAGCCCGGGAACCCAGGG + Intronic
1147400775 17:40178787-40178809 CTGAACAGTCAGGGACCCCAGGG - Intronic
1147999625 17:44380167-44380189 CAGAAGAGTCAGGACCTCCCTGG + Intronic
1148124106 17:45228165-45228187 CCGAGGAGCCAGGCACTCCAGGG - Intronic
1148794152 17:50189167-50189189 CAGAGGGGCCAGGAAGACCAGGG + Exonic
1151397977 17:73837231-73837253 CAGAGGAGGCCAGAACCCCAGGG - Intergenic
1151676485 17:75601459-75601481 CAGAAGAGCCACTATCACCATGG + Intergenic
1151820411 17:76493907-76493929 CAGAAGATCAAGAACCCCCAGGG + Intronic
1155168772 18:23251591-23251613 CAGAGGAGCAAGGAAGACCAGGG + Intronic
1157484385 18:48076624-48076646 GAGAAGATGCAAGAACCCCATGG + Intronic
1158278425 18:55794044-55794066 CAGGAAAGTCAGGAACCTCACGG - Intergenic
1158315781 18:56210144-56210166 CAGAAGAGCCAGGAGCCTCAGGG - Intergenic
1158973632 18:62691029-62691051 GAGAATAGCCAAGAAACCCAAGG - Intergenic
1160081047 18:75727500-75727522 CAGAAGAGCAAGAACCCCCCAGG + Intergenic
1160281972 18:77499353-77499375 CACCAGAGCCAGGAACCACCAGG - Intergenic
1160488768 18:79319355-79319377 CAGGAGAGGCAGGGACCCCTAGG - Intronic
1160587184 18:79919252-79919274 CAGCACAGCCAGGAAGCCCAGGG + Exonic
1160904600 19:1446286-1446308 CAGGAGCCCCAGGAGCCCCATGG - Intronic
1160927474 19:1553788-1553810 CAAAACAGCCAGGAAGCCCCTGG - Intergenic
1161038526 19:2098172-2098194 AAGGAGAGCCTGGGACCCCAGGG - Intronic
1161090658 19:2358369-2358391 GAGAAGAGCCTGTGACCCCATGG - Intergenic
1161093796 19:2377144-2377166 CAATAGAGCCAAGAGCCCCAGGG - Intergenic
1161098062 19:2405225-2405247 CAGAAGAGTCAGGGAAGCCAAGG + Intronic
1161222173 19:3122845-3122867 CAGAAGAGCGGGGAGCCCCGTGG + Exonic
1161356199 19:3820743-3820765 CAGGAGACACAGGAACACCAGGG + Intronic
1162299363 19:9835498-9835520 CGGAAGAGCCAGGACCCCATGGG - Intronic
1162833473 19:13301373-13301395 CAGAAGAGCCTGGCATCCGATGG + Intronic
1164182644 19:22832737-22832759 AAGATGAACTAGGAACCCCACGG - Intergenic
1164755356 19:30685193-30685215 CAGAAAATCCAGAGACCCCAAGG - Intronic
1165045782 19:33103873-33103895 GAGAAGCGCCAGGAACCCCCAGG - Intronic
1166945913 19:46396136-46396158 CAAAAGGGGCAGGAACTCCAAGG - Intergenic
1167096600 19:47377881-47377903 CAGCAGAGCCATGGGCCCCATGG + Intronic
1167490738 19:49791632-49791654 CAGCAGTGCCTGGTACCCCATGG + Intronic
1167659912 19:50790506-50790528 CACCAGAGCCACGAACACCAGGG - Exonic
1167783489 19:51616150-51616172 CAGAGTAGCCAATAACCCCAGGG + Intronic
925055815 2:856531-856553 GAGAAGAGCCTGGGGCCCCAGGG - Intergenic
925178928 2:1804046-1804068 CAGAGGCCCCAGCAACCCCAGGG - Intronic
925186724 2:1852026-1852048 CAGCAGAGCCAGCAACCACAGGG + Intronic
925351107 2:3201193-3201215 CAAAAGCGCCGGGAACACCAGGG + Intronic
925702850 2:6656343-6656365 CAGAAAACCCAGAGACCCCAGGG + Intergenic
926794697 2:16609283-16609305 GAGAAGAGCCTGGGGCCCCAGGG - Intronic
927603125 2:24461987-24462009 CAGATGAGCCGGGAACCCTGGGG - Intergenic
927683463 2:25155144-25155166 CAGAAGCTCCAGGAACACCTTGG - Exonic
927863287 2:26573703-26573725 GAGAAGAGTCAGGACCGCCAGGG + Intronic
927904133 2:26845283-26845305 CAGCAGAGCCAGGATTCCAAAGG - Intergenic
927929407 2:27034497-27034519 TTGAAGACCCAGGAACACCAGGG + Intronic
928253453 2:29701635-29701657 TAGAAGAGCCCTGACCCCCATGG + Intronic
928308606 2:30191758-30191780 TAGAAGAGCCAGTAATCCCAGGG + Intergenic
929642438 2:43595553-43595575 CTGAAGAACCAGGGTCCCCAAGG + Intronic
929913493 2:46114143-46114165 AAGCAGAGCCAAGAACCGCAGGG - Intronic
932343708 2:70982336-70982358 CTGAGGAGCCAGGGGCCCCAGGG - Intronic
932919073 2:75889113-75889135 CAGAAGTTCCAGGAGCCCCGGGG - Intergenic
933509173 2:83218138-83218160 CAGCAATGCCAGGAACACCAGGG - Intergenic
933596144 2:84285197-84285219 GGGAAGAGCCTGGATCCCCATGG - Intergenic
933778550 2:85786507-85786529 CAGAGGAGCCTGCCACCCCAGGG + Intronic
934974282 2:98789604-98789626 CAGAAGACCCAGGAACCAGGGGG + Intergenic
935180158 2:100682041-100682063 GAGCAGAGCCAGGTACCCAAAGG - Intergenic
936292304 2:111235622-111235644 CAGGAGAGCCAAGAGCCACAAGG + Intergenic
937258006 2:120568349-120568371 AGGAGGAGCCAGGAGCCCCAGGG - Intergenic
937907636 2:127060035-127060057 CACAGGAGCCAGTTACCCCATGG - Intronic
939508360 2:143076175-143076197 CTGAAGGGCCAGGACCCTCATGG + Intergenic
942717499 2:178909953-178909975 AAGAAGAGCTAGGAACCAGAGGG - Intronic
943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG + Exonic
946648120 2:221861501-221861523 AAGAAAAGCCAGGAACCAGATGG - Intergenic
947729171 2:232418717-232418739 CGCCAAAGCCAGGAACCCCAAGG - Intergenic
948165850 2:235861959-235861981 CAGGACACTCAGGAACCCCACGG - Intronic
948369929 2:237482448-237482470 AAGAACATGCAGGAACCCCAGGG + Intergenic
948407900 2:237736627-237736649 CAGAAGAGCAATGAAGGCCAAGG - Intronic
948641636 2:239379103-239379125 CAGAAGTGACAGGGAGCCCAGGG + Intronic
1171977911 20:31607029-31607051 TGGATGAGCCAGGAGCCCCAGGG - Intergenic
1172620484 20:36315548-36315570 CAGACCATCCAGCAACCCCAGGG - Intronic
1175261748 20:57678995-57679017 CAGAAGAGCCAGGAACTGCAGGG + Intronic
1175558318 20:59891741-59891763 AAGAAGAGACAGGAACTGCATGG + Intronic
1175890482 20:62313740-62313762 CAGATGATCCAGGAAACCAAGGG - Exonic
1175973166 20:62697354-62697376 CAGCAAAGCCCTGAACCCCAAGG + Intergenic
1176522289 21:7833568-7833590 CTGAAGATCCAGAAGCCCCAGGG - Intergenic
1178656309 21:34463580-34463602 CTGAAGATCCAGAAGCCCCAGGG - Intergenic
1179297560 21:40077268-40077290 CAGAAGTGCCAGGAAGACCCTGG + Intronic
1179933270 21:44586097-44586119 CAGGAGAGCCAGGCAGGCCAGGG - Intronic
1180018347 21:45102521-45102543 CACAAGTGCCAGGAATGCCAAGG + Intronic
1180312091 22:11249749-11249771 CAGAACAGCTGGGCACCCCAAGG + Intergenic
1181719706 22:24764156-24764178 CAGAAGAGGCCGGGACCCCAGGG - Intronic
1182036040 22:27199057-27199079 CAGATGTGCCAGGAAACTCATGG - Intergenic
1183473235 22:38020828-38020850 CAGAAGAACCAAGAAAACCATGG - Intronic
1184746911 22:46461550-46461572 CAGATGAGTCAGGAGCCCTAGGG - Intronic
950162817 3:10772684-10772706 CAGGTGAGGCTGGAACCCCAGGG + Intergenic
950528876 3:13540835-13540857 GAGAAGAGCCTGGGACTCCAGGG + Intergenic
951885638 3:27521342-27521364 CAGAACAGCAAGGATTCCCATGG + Intergenic
952482017 3:33771306-33771328 CAGAAGTGCCAGAAACACAAGGG + Intergenic
952838986 3:37628387-37628409 CAGAAAAGCCAAGAGCTCCAGGG + Intronic
953308886 3:41857584-41857606 AAGAAAAGCCAGGAACCTGATGG - Intronic
953572245 3:44080198-44080220 CAGAAGAGACAGGAGCTCCCTGG - Intergenic
953679962 3:45031586-45031608 GTGCAGAGCCAGGAACACCAAGG - Intronic
954109379 3:48425539-48425561 CAGCAGAGCCAGGCACCCGAGGG + Intronic
954686249 3:52371845-52371867 CAGAAGGGCCAGGAGCTGCACGG - Intronic
958745454 3:98128542-98128564 CAGAAGAGCAAGGAAACTGAAGG + Intergenic
958752048 3:98203221-98203243 CAGAAGAGCAAGGAAACTGAAGG + Intergenic
958892320 3:99795346-99795368 AGGGAGAGCCAGGAATCCCAGGG + Exonic
961565487 3:127760623-127760645 CAGATGATGCAGAAACCCCAGGG + Intronic
963751742 3:149186886-149186908 CTGAAATGCCAGGAACCACAAGG - Intronic
964254018 3:154754006-154754028 AAGAAAAGCCAGATACCCCATGG + Intergenic
964254224 3:154757155-154757177 AAGAAAAGCCAGAGACCCCATGG + Intergenic
965636922 3:170791804-170791826 AAGAATTGCCAAGAACCCCAAGG + Intronic
967135154 3:186506934-186506956 CAGAAAAGGCATGTACCCCAAGG + Intergenic
967649795 3:191972929-191972951 CAGAGTTGCCAGGAACCACAGGG + Intergenic
968406608 4:345158-345180 CAGAAATCCCAGGAACACCAAGG + Intronic
968459024 4:714595-714617 CAGAAGGGCCAGGACCTCCAGGG - Intronic
968512656 4:1002462-1002484 CAGCAGCGCCAGCAGCCCCATGG - Exonic
968519524 4:1029279-1029301 TGGAAGAGCCAGGAAGCCCCAGG - Intergenic
968807677 4:2786388-2786410 CAGAAGACTCAGGACCCCAAGGG - Intergenic
968872442 4:3248691-3248713 CAGGACACCCAGGAGCCCCAGGG + Exonic
968970886 4:3793122-3793144 GAGAAGAGTGAGGAGCCCCACGG - Intergenic
969600821 4:8175224-8175246 TGGTAGAGCCAGGAACACCAAGG + Intergenic
974867578 4:67599327-67599349 AAGAAGAGCCTGGGACCCAATGG - Intronic
975052237 4:69880284-69880306 GAGAAGTGCTAAGAACCCCAGGG + Intergenic
977239495 4:94549756-94549778 CAGTAGAGCCAGGAAGACAAAGG - Intronic
977641865 4:99366837-99366859 AAGAAGAGCCTGGGACCCAACGG - Intergenic
978480331 4:109182609-109182631 CTAAAGAGCCAGGAACGCCCAGG + Intronic
980745587 4:137009570-137009592 AAGAAGAGCCTGGAACCTGATGG - Intergenic
981253363 4:142630171-142630193 CAGAAGAGGCATGAAAACCAAGG + Intronic
982218028 4:153099426-153099448 CAGCATAGCCAGGAACAACATGG + Intergenic
983034698 4:162848957-162848979 GAGATTAGCCAGGAGCCCCAAGG - Intergenic
983197590 4:164824506-164824528 CTGAAGACACAGGAACACCAAGG - Intergenic
985540775 5:486443-486465 GAGAAGATTCAGGAACCCCAAGG - Intronic
986144613 5:5065733-5065755 CTGTAGAGGCAGGAAGCCCAGGG + Intergenic
988360835 5:30234575-30234597 CAGAAGGTTCAGGAACTCCAGGG + Intergenic
989989738 5:50747285-50747307 AAGATGAGCCAGGGAACCCAGGG + Intronic
990061973 5:51661361-51661383 CAGCAGAGCCATGACCTCCAAGG - Intergenic
990875108 5:60475397-60475419 CAGAAGAGCCAGGTCCTTCAAGG + Intronic
991690367 5:69219438-69219460 AAATAGAGCCAGGGACCCCATGG - Intronic
996991660 5:129640601-129640623 CAGAAGAGCCAGGAAAGACTAGG - Intronic
997897879 5:137736050-137736072 CAGAGGAGGCAGGAGCCCCAGGG - Exonic
999110911 5:149120937-149120959 GAGATCAGCTAGGAACCCCAAGG + Intergenic
999237360 5:150106883-150106905 GAGAAGTGCCAGGAAACTCAGGG - Intronic
1002329597 5:178432512-178432534 CAGAAGACCCAGGAGCTACAGGG + Intronic
1004504566 6:16237891-16237913 CCAAAGAACCAGAAACCCCAGGG - Intergenic
1006239010 6:32661331-32661353 CAGAAAGGTGAGGAACCCCAGGG - Exonic
1006295779 6:33169425-33169447 CAGGAGAGCCAGGGCCACCAGGG - Exonic
1006295870 6:33169855-33169877 CAGGAGAGTCAGGATCTCCAGGG - Exonic
1006556736 6:34873329-34873351 CAGATGTGCCAGGGACCCCAGGG - Exonic
1006646865 6:35520954-35520976 CAGCAGAGTCAGGAATCCCTGGG + Intergenic
1006669404 6:35720313-35720335 CAGAGGAGGTAGGGACCCCATGG - Exonic
1007309553 6:40934658-40934680 CAGCAGGGCCAGGGATCCCAAGG + Intergenic
1007570974 6:42890682-42890704 CAGCAGGGCCAGGAACTCCCGGG - Exonic
1007725800 6:43914967-43914989 CAGAAGAGCCTAGATCTCCAGGG + Intergenic
1008100098 6:47380853-47380875 CAAAAGACCCAGGGACCCCTAGG + Intergenic
1009371563 6:62909893-62909915 AAGAAAAGCCTGGAACCCAATGG + Intergenic
1011334366 6:86243655-86243677 AAGGAGAGCCTGGAAACCCAAGG + Intergenic
1012343507 6:98157175-98157197 CAGCAGGGCCTGGAACTCCAGGG - Intergenic
1012752801 6:103184427-103184449 GAGAGGAGCTAGCAACCCCAGGG + Intergenic
1012900650 6:105002101-105002123 CAGAAGGGTCAGGAAGCCCCGGG - Intronic
1013636531 6:112034181-112034203 CAGAAAAGCCAGGAAACTAAAGG - Intergenic
1014609385 6:123522285-123522307 CAGAAAAGACAGGAACCCAGTGG - Intronic
1016539647 6:145150223-145150245 CAGAAGCACCAGGAACCCCTCGG - Intergenic
1016604484 6:145904592-145904614 AAGAAGAGACAGGAAGCACAAGG + Intronic
1016737224 6:147492551-147492573 CAGGGGTGCCAGGAATCCCAAGG - Intergenic
1017658581 6:156652627-156652649 CAGAAGAACCAGGGATTCCAGGG - Intergenic
1019318203 7:401245-401267 CAGGAGAGGGAGGATCCCCAGGG - Intergenic
1019745793 7:2699877-2699899 CAGAAGGGCAAGGGCCCCCAAGG - Intronic
1020558138 7:9694305-9694327 GAGATTAGCTAGGAACCCCAAGG - Intergenic
1022521354 7:31009295-31009317 GAGAAGAGCCAGGAAACAGAGGG - Intergenic
1022557861 7:31317778-31317800 CAGGATAGCCAGGATTCCCAGGG + Intergenic
1022566448 7:31407525-31407547 CCAAAGATCCAGGGACCCCATGG + Intergenic
1022955716 7:35378244-35378266 CAGAAGTGGCGGGGACCCCAGGG + Intergenic
1023286213 7:38623086-38623108 CACAAGAGACAGGGACCCCTGGG + Intronic
1023622060 7:42083549-42083571 CAGCTGAGACAGGAAACCCATGG + Intronic
1023874613 7:44280155-44280177 CAGAGGGGCCAGGAAGCCCTGGG + Intronic
1024316225 7:48019805-48019827 AAGAACAGCCCGGGACCCCATGG + Intronic
1024527136 7:50358353-50358375 CAGAAGTGCCAGGAAGCCAGAGG + Intronic
1024574626 7:50753850-50753872 AAGAAAAGGCAGGAAGCCCAAGG + Intronic
1025607035 7:63047016-63047038 TAGAAGAGCGAGGCATCCCACGG + Intergenic
1026143698 7:67727456-67727478 AAGAAGAGCTGGGAACCACAGGG + Intergenic
1026457864 7:70588592-70588614 CGGAAGAGGCAGGGACCCCAGGG + Intronic
1026776585 7:73234825-73234847 CAGGAGAGGCAGGACCCTCACGG + Intergenic
1027017436 7:74788195-74788217 CAGGAGAGGCAGGACCCTCACGG + Intronic
1027116557 7:75486056-75486078 CAGAGGGGCCGGGAGCCCCAGGG - Exonic
1027363216 7:77430837-77430859 CAGCAGAGCCACAGACCCCAGGG + Intergenic
1028959538 7:96733135-96733157 CATAAGAGCCAGGAATTCCATGG + Intergenic
1030102714 7:105960643-105960665 CAGGAGAGCCAAGGACCGCAAGG + Intronic
1030488376 7:110200308-110200330 AAGAAAAGCCTGGAACCCAATGG - Intergenic
1030854832 7:114542463-114542485 TAGAAGAACCTGGAACCCTAAGG + Intronic
1033959727 7:146899664-146899686 AAGAAGAACCAGGAAATCCAAGG + Intronic
1034636304 7:152569940-152569962 CAGAAGAGCTGGCAAACCCATGG - Intergenic
1036249948 8:7153273-7153295 CATAAGAGACAGGTACGCCATGG + Intergenic
1039838807 8:41279014-41279036 AAGGAGAGCCAGGAAGGCCAAGG - Intronic
1041472064 8:58221812-58221834 CAAAACAGCCAGAAACCCCATGG + Intergenic
1042032720 8:64494188-64494210 CAGAAAAGCCTGGGACCCTATGG + Intergenic
1043295993 8:78664835-78664857 CAGAAGAGCCAGGGGAACCAGGG + Intergenic
1043924171 8:86018092-86018114 TAGAATAGTCAGGAAGCCCATGG + Intronic
1044840649 8:96333922-96333944 CAGACGAGGCATTAACCCCATGG + Exonic
1046014598 8:108590182-108590204 CAGGGGCGCCTGGAACCCCAGGG + Intergenic
1046984174 8:120369358-120369380 CAGGAGAGCCAGGGGGCCCAGGG - Exonic
1048284458 8:133130949-133130971 CAGAGAAGCCAGGAGGCCCAGGG - Intronic
1049103025 8:140592912-140592934 CTGAGGAGCCAGGAGCTCCATGG + Intronic
1049198891 8:141330292-141330314 AAGGAGAGGCAGGCACCCCAGGG - Intergenic
1049372986 8:142276540-142276562 CAGCAGAGACAGGAAGGCCATGG + Intronic
1049449519 8:142652947-142652969 CAGACTGGCCAGGTACCCCACGG + Intergenic
1049741059 8:144241130-144241152 CAGAAGCCCCAGACACCCCAGGG + Intronic
1049802702 8:144525558-144525580 CAGAGGAGCTACGAGCCCCAGGG + Intronic
1051452143 9:17208582-17208604 CAGAAGAGCCCAGCACCCAATGG - Intronic
1053392318 9:37744734-37744756 CAGAGGAGCCAGCAGCCCCAAGG - Exonic
1055888612 9:81097688-81097710 CAGAAGGGCCAGAAATGCCAAGG + Intergenic
1056293595 9:85169239-85169261 CAGGAGAGCCACCAATCCCAGGG - Intergenic
1057046351 9:91889275-91889297 CAGAGGAGCCAGGAGTCCCAGGG + Intronic
1057693882 9:97310190-97310212 AAGAAGAGGCAGGAAGGCCAGGG + Intronic
1058961896 9:109999446-109999468 CTGGAGAGGCAGGAACCACATGG - Intronic
1059286253 9:113174251-113174273 CAGGAGAGCCAGGAATCAAATGG - Intronic
1059320521 9:113464844-113464866 CAGAAGAGCCAGGAACCCCAGGG - Intronic
1061278228 9:129581739-129581761 TAGAAGAGGCAGGGACGCCAGGG + Intergenic
1061534065 9:131236699-131236721 CAGATGGTCCATGAACCCCATGG + Intergenic
1061818595 9:133210134-133210156 CAGCAGAGCCAGGTGCCCAAGGG - Intergenic
1061868757 9:133509038-133509060 CAGAAGAGGCAGGAAGCAGATGG - Intergenic
1061878595 9:133557212-133557234 CTGGTGAGCCAGGAGCCCCAGGG + Intronic
1061904545 9:133689970-133689992 CGGAGGAGCCAGGGACCCCTCGG + Intronic
1062277453 9:135737572-135737594 CAGAAGAGCCGGGGACTCCTGGG + Intronic
1062338527 9:136083181-136083203 CAGAAGAGCCAGTGGCCACAGGG + Intronic
1062479332 9:136744217-136744239 CAGTGGAGCCATGAACCCCGTGG + Intronic
1185504769 X:624124-624146 CAGACGAGCCAGGATCCCAGGGG - Intergenic
1185512517 X:674068-674090 CAGATGAGGCAGAGACCCCAAGG + Intergenic
1187957099 X:24530049-24530071 CAGAAGAGCCGAGAACTCCGAGG - Intronic
1188248669 X:27864343-27864365 CGGAAGCTCCAAGAACCCCAGGG + Intergenic
1189192092 X:39119046-39119068 AAGAAGCTCCAGGAACCCCTGGG + Intergenic
1189268994 X:39737186-39737208 AAGGACAGCCAGGAAGCCCATGG + Intergenic
1189657661 X:43263105-43263127 AAGAAAAGCCAGGAACCTGATGG - Intergenic
1189910400 X:45805195-45805217 GAGAAGAGCCAGGAACGATAAGG + Intergenic
1190143746 X:47871756-47871778 CAGAAGAGTCAGGTGACCCAAGG + Intronic
1190978933 X:55437680-55437702 AAGAAAAGCCAGTGACCCCATGG + Intergenic
1191750478 X:64536772-64536794 CAAAAGAGCCTATAACCCCATGG + Intergenic
1192239509 X:69318273-69318295 CAAAAGAGGCTGGAACTCCAAGG - Intergenic
1192819904 X:74634236-74634258 CAGAGGAACCAGGAACCACCAGG + Intergenic
1192944504 X:75950337-75950359 CACAAGAGCAAGGAAAACCAGGG - Intergenic
1192975881 X:76284822-76284844 AAGAAAAGCCTGGAACCCAATGG - Intergenic
1193538982 X:82747549-82747571 GAGAAGACTCAGGAACCCGAAGG - Intergenic
1194254200 X:91616017-91616039 CAGGAAAGCCAGGAACCCAGTGG + Intergenic
1195067544 X:101250981-101251003 CAGAACAGCCAGCCACACCATGG - Exonic
1196080730 X:111627890-111627912 GAGAGGAGCCAGGAACCAAAGGG - Intergenic
1196692111 X:118571104-118571126 CACAAAAGGCTGGAACCCCATGG - Intronic
1197505971 X:127305926-127305948 CAGTGGAGCCTGGAACCCCAGGG + Intergenic
1199893317 X:152109656-152109678 AAGATGGGCCAGGAACACCATGG - Intergenic
1200083525 X:153591539-153591561 CAGCATAGCCAGGCAGCCCAGGG + Intronic
1200097013 X:153669214-153669236 CAGAAGAGTAGGGGACCCCAGGG - Intergenic
1200365438 X:155657631-155657653 CAGTGGCGCCTGGAACCCCAGGG - Intronic