ID: 1059322659

View in Genome Browser
Species Human (GRCh38)
Location 9:113481547-113481569
Sequence CTGTTTGCACAGCTGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059322659_1059322661 -2 Left 1059322659 9:113481547-113481569 CCTGACTCCAGCTGTGCAAACAG 0: 1
1: 0
2: 0
3: 26
4: 218
Right 1059322661 9:113481568-113481590 AGTTTTTGCAAAATGCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059322659 Original CRISPR CTGTTTGCACAGCTGGAGTC AGG (reversed) Intronic
900139721 1:1134629-1134651 GTGTTTGCACATTTGGAGGCCGG + Intergenic
900856204 1:5186666-5186688 CTATTTGCAGAACTGGATTCTGG - Intergenic
901671999 1:10861584-10861606 CAGTTTCCCCAGCTTGAGTCTGG + Intergenic
902397510 1:16140358-16140380 CTCTGTGCAGAGCAGGAGTCGGG - Intronic
903143705 1:21356129-21356151 CTGTTTTCACAGCAGGTGTTGGG + Intergenic
904205116 1:28849283-28849305 CTGTTGGCAGAGCTGGAGAAAGG - Intronic
904895927 1:33818220-33818242 CTCTCTGCACAGCTGGTGTCTGG + Intronic
906264341 1:44417380-44417402 ATGTTTGCACAGCTAAAGTGGGG + Intronic
906725348 1:48040304-48040326 ATGTTTGCACAGCTGGGGATGGG + Intergenic
907413399 1:54297964-54297986 CTGTTTCCCCTGCTGGGGTCAGG - Intronic
909784417 1:79593228-79593250 TTGGTTGCACAGCTGGAGAAGGG - Intergenic
911947101 1:104125669-104125691 CTGTTTTCACAGCTGAACACTGG + Intergenic
912140788 1:106723910-106723932 CTTTTTGAACAGCTGTTGTCTGG + Intergenic
912841107 1:113040258-113040280 CTGTTTGTACAAATGCAGTCAGG + Intergenic
913018608 1:114764393-114764415 CTGCTTTCACAGCTGGCGTTAGG - Intergenic
913520453 1:119640590-119640612 CTGTTTGCACAGCTGAATCAAGG - Intronic
915318205 1:155041554-155041576 CTGTGTCGACAGGTGGAGTCTGG - Exonic
919723855 1:200869561-200869583 CTCTCTGCACTGCTGGAGCCAGG - Intergenic
922874632 1:228930671-228930693 CTGTTTGCACCGCAGCAGACAGG - Intergenic
922994113 1:229942544-229942566 ATGTTTGCACAGCTGCAGTTTGG + Intergenic
923412647 1:233725406-233725428 CTGTTTGCACTGGGGGAGGCTGG - Intergenic
1062916999 10:1248154-1248176 CTGTTTGGTCAGCTGGAGACGGG - Intronic
1062917019 10:1248283-1248305 CTGTTTGGTCAGCTGGAGACGGG - Intronic
1062917038 10:1248412-1248434 CTGTTTGGTCAGCTGGAGACGGG - Intronic
1063334430 10:5198327-5198349 CTGTTTTCAAAGTTGGAGCCTGG + Intronic
1065293802 10:24256216-24256238 CTGTGTGCAGAGTTGTAGTCAGG - Intronic
1068739468 10:60452144-60452166 CTGTGTGCACCGCTAGAGGCTGG - Intronic
1070112328 10:73497697-73497719 CCTTTTGAACAGATGGAGTCAGG - Exonic
1071105673 10:82091612-82091634 CTGTTTGTACAGCTGGTCTTGGG - Intronic
1073326960 10:102648709-102648731 AGGTTTGCACTGCTGGAGTCAGG - Intronic
1074473085 10:113744814-113744836 CTGTCTGCAGAGGTGGAGGCAGG - Intergenic
1076330479 10:129660813-129660835 CAGTTTGCATAGCCGGAGTAGGG + Intronic
1077069895 11:664404-664426 CGGTGTGAATAGCTGGAGTCAGG - Intronic
1077222743 11:1424718-1424740 CTGTTTGGACAGAGGGAGTCGGG + Intronic
1077475932 11:2790487-2790509 CTGTGTGCACAGCTGGATGCTGG - Intronic
1077867582 11:6235365-6235387 CTGCATGCCCAGCTGGATTCCGG + Intronic
1078832128 11:14987836-14987858 CTGGTGACACAGCTGAAGTCAGG + Intronic
1078948041 11:16093978-16094000 CTGTTTGCTCATGTGGACTCTGG - Intronic
1079091896 11:17486532-17486554 CTGTTTGCACACGTGGACTGTGG + Intergenic
1080376688 11:31721561-31721583 CTGACTGCTCAGCTGGAATCTGG + Intronic
1080579709 11:33632233-33632255 CTGTATCCACAGGTGGACTCTGG + Intronic
1084102204 11:66957258-66957280 CTGTTTTCTCAGCTGGAGAACGG + Intronic
1084495477 11:69500841-69500863 CTGTTTGCTCTGCTGGAGATGGG + Intergenic
1084657312 11:70527122-70527144 CTGATTCCACAGCTGTGGTCTGG + Intronic
1084888952 11:72227264-72227286 CTGTTTCCTCAGCTGGAGAATGG + Intronic
1089001988 11:115059856-115059878 CTGTTTGTACTGCTGGAGGCTGG - Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091275497 11:134346711-134346733 TTGGTTCCAAAGCTGGAGTCAGG - Intronic
1091421570 12:345390-345412 CTTTTTGCAGAGCTGAATTCAGG - Intronic
1092500430 12:9040956-9040978 CATTTTGCACAGCTGCTGTCAGG - Intergenic
1092505073 12:9090397-9090419 CCGTTTGCACAGATGCAGTGAGG + Exonic
1093672803 12:21898107-21898129 ATGTTTGCACTGCTGCACTCTGG + Intronic
1096999090 12:55861293-55861315 CTGTCTGCCAAGCTGGAGTGCGG + Intergenic
1097156434 12:57015608-57015630 CTGTCTGGACAGCTGTAGTGAGG - Intronic
1099308361 12:80986474-80986496 CTGTTTTCACAACTGGATTGTGG - Intronic
1100656938 12:96656963-96656985 CAGTATGCACACCTGAAGTCAGG - Intronic
1101187245 12:102292172-102292194 CTGTTTCCCCTGCTGGACTCAGG - Intergenic
1101970102 12:109307059-109307081 CTGTGTGCAGAGCTGGGGCCAGG - Intronic
1102728806 12:115089752-115089774 CTGTCTGCACTGCTGGCTTCTGG + Intergenic
1103888089 12:124217644-124217666 CTGTTTCCAGAGCTGGGGTGCGG - Intronic
1107721887 13:43258081-43258103 ATGTTTCCACTGCTGGAGGCTGG - Intronic
1108840554 13:54608565-54608587 CTGTTTGAGGAGCTGTAGTCAGG - Intergenic
1114588694 14:23839358-23839380 CTGTATCCAGAGCTAGAGTCAGG + Intergenic
1121358045 14:93231451-93231473 CTCTTTGCAGAGTTGCAGTCAGG - Intergenic
1121401871 14:93686808-93686830 CTCTTTGCAAAGCTGGACCCTGG - Intronic
1122605386 14:102944606-102944628 CTGTGTGCACAGCCTGAGCCCGG + Intronic
1128432857 15:67615447-67615469 CTGTTTTAACAGCTAGAGCCTGG + Intronic
1129066776 15:72911774-72911796 CTATTTGCACATGTGTAGTCAGG + Intergenic
1130056137 15:80527717-80527739 CAGTTTGCACAGCTGGTAACTGG + Intronic
1130876075 15:88015650-88015672 CTGTCTCCCCAGCTGGAGTGTGG + Intronic
1131050769 15:89346433-89346455 CAGTTTGGACAGGTGGAGCCAGG - Intergenic
1131699374 15:94917606-94917628 CTGATTGCACAGCTCAAGTGTGG - Intergenic
1135916824 16:26612843-26612865 GTGTTTGCACACCTGCACTCTGG - Intergenic
1139192532 16:64881224-64881246 TTGTTTGCACAGCTGGAAAAGGG + Intergenic
1139477894 16:67211951-67211973 GGGAGTGCACAGCTGGAGTCAGG + Intronic
1139512057 16:67433130-67433152 CTGGTTGCAAAGCTGGGGTTGGG + Intronic
1139740968 16:69034500-69034522 CTGTAACCACAGCTGGAGCCTGG - Intronic
1141463791 16:84194140-84194162 CGGTTTGCCCAACTTGAGTCAGG - Exonic
1141805497 16:86338820-86338842 CTCTTTGCAGGGCTTGAGTCTGG - Intergenic
1142585820 17:972650-972672 CTTTGTGCACAGCTGGGGTCGGG - Intronic
1143756567 17:9072077-9072099 CCCTTTGCACAGCTGAGGTCTGG + Intronic
1146351790 17:32101567-32101589 CGGTTTCCACATGTGGAGTCTGG + Intergenic
1146954237 17:36927745-36927767 ATCTTCGCACCGCTGGAGTCAGG + Intergenic
1148343750 17:46889804-46889826 CTGAGTGCAAAGCTGGGGTCTGG - Intergenic
1151582304 17:74987537-74987559 ATGTATGCAAAGCTGGAGGCGGG - Intergenic
1152224335 17:79085769-79085791 CTGTTTGTCCAGCTGGAGTGGGG + Intronic
1152490159 17:80625886-80625908 AGATTTGCACAGCTGGAGACGGG - Intronic
1153994986 18:10432886-10432908 CTGTTTGCACAGCAGTAGAATGG + Intergenic
1155989606 18:32266413-32266435 CTGTCCGCACATCTGGAATCTGG + Intronic
1157559826 18:48638322-48638344 CTGTTTGGTCAGCAGGTGTCTGG + Intronic
1157586531 18:48804802-48804824 CTTCTAGCAGAGCTGGAGTCAGG - Intronic
1159397300 18:67877076-67877098 CTGTTTGCACTGCAGGACTGTGG + Intergenic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1159894779 18:73985849-73985871 TTGTCTGCACAGATGGGGTCTGG - Intergenic
1160588566 18:79927144-79927166 CTGCCTGCTCAGCTGGAGTGGGG - Intronic
1160800678 19:966648-966670 CTGCTTGCACAGCTGCTGCCTGG - Exonic
1163150951 19:15413698-15413720 CTGTTTGCTCAACTGGCCTCTGG + Intronic
1164604502 19:29587742-29587764 CTGTTTTCATAGCTGGTGGCAGG + Intergenic
1164870894 19:31641782-31641804 CTGATTGGACAACTGAAGTCAGG - Intergenic
1166195527 19:41203359-41203381 CTGCTTGCATAGCTGTAGTTTGG - Intronic
1166318527 19:42002528-42002550 CTGGATGCAGAGCTGGGGTCTGG + Intronic
927413746 2:22855483-22855505 CTGTTTGGACAACTGTAGCCAGG + Intergenic
928791480 2:34960781-34960803 CTGTTTGCAGAGATGAAGTCTGG - Intergenic
932354743 2:71059476-71059498 TTATTTGCACAGATGTAGTCTGG - Intergenic
932813276 2:74841966-74841988 CTGTTTGATGAGCTGGAGTCAGG + Intronic
935585390 2:104796219-104796241 CTGTTTACAGAGGTGGAGTGAGG + Intergenic
936328258 2:111524032-111524054 CTGTGTGCATAGCTGGAGATGGG + Intergenic
936385496 2:112024891-112024913 CTGTTTCCCAGGCTGGAGTCTGG - Intronic
936953848 2:118004742-118004764 CTGTGGGCAAAGCTGGAGACGGG - Intronic
938856048 2:135312233-135312255 CTGTTGCCAAAGCTGGAGTGCGG + Intronic
939228016 2:139388142-139388164 CTGTGTGCACTGCTGGTGACTGG - Intergenic
940078103 2:149766689-149766711 CTATTTGCCCATCTGGAGCCTGG + Intergenic
942269358 2:174258468-174258490 CAATTTGCACAGCTTGGGTCAGG - Intergenic
943916725 2:193644308-193644330 CTGTTTCTACATCTGAAGTCAGG + Intergenic
944356452 2:198794693-198794715 GTGTTTGGACAGCTTGAGTGGGG + Intergenic
946012689 2:216579093-216579115 CTGTTTGCAAAGCTAGTTTCTGG - Intronic
946488022 2:220119663-220119685 TTGTTGTCACAGCTGGAGACAGG + Intergenic
947710386 2:232310423-232310445 CTGCTTCCACTGCTGGATTCGGG + Intronic
948695317 2:239730202-239730224 CTGTTTGGAGAGCCGCAGTCAGG - Intergenic
1169268272 20:4180871-4180893 CTGTCTCCCCAGCTGGAGTGAGG + Intronic
1170613819 20:17933892-17933914 CTGTGTGCATAGCTGCAGCCAGG + Intergenic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172749575 20:37240891-37240913 TGGTTGGCAGAGCTGGAGTCTGG + Intronic
1172771583 20:37385398-37385420 CTGTCTGCACCGCTGGGGCCCGG - Intronic
1173857597 20:46260670-46260692 CTGCTTGCACTTCCGGAGTCTGG + Intronic
1174129429 20:48331966-48331988 TTGTTTGAAAAGCTTGAGTCTGG - Intergenic
1174429220 20:50455923-50455945 CTGCTCCCACAGCTGGAGACAGG - Intergenic
1175857491 20:62130146-62130168 CTGCTTCCACAGCTGGGTTCTGG + Intronic
1176201341 20:63862105-63862127 CTGTCTGCACCGCTCGAGGCCGG + Exonic
1178590183 21:33902961-33902983 CTGTCTGGACAGCTGGTGTCAGG - Intronic
1179181824 21:39051769-39051791 CTGCCTGCAGAGCTGGAATCAGG + Intergenic
1179491445 21:41744052-41744074 CTGCTCTCACAGCTGGACTCTGG - Exonic
1179547726 21:42123974-42123996 CTGTGTGCACAGATGGGCTCTGG + Intronic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181024552 22:20120612-20120634 CTGAGTGCACTGCTGGATTCTGG + Intronic
1181068369 22:20317174-20317196 CTGTAGGCACAGCGGGAGCCAGG - Intronic
1182038570 22:27218645-27218667 TTCTCTGCACAGCTGGACTCAGG - Intergenic
1182500549 22:30743588-30743610 CTGCTGGCACAGCTGGGCTCAGG + Intronic
1182572682 22:31250525-31250547 CCGTTTGCCCAGCTAGAGTCTGG + Intronic
1183010709 22:34944379-34944401 CTGTTTACACAGCAGGGGTTGGG - Intergenic
1183299932 22:37053851-37053873 CTGTTAGCAGAGCTGCAGCCAGG + Intronic
1183960320 22:41407706-41407728 CTGTTGACACGGCTGGAGTGTGG + Intergenic
1184567483 22:45300779-45300801 CTTTTTGCACAGGTGAGGTCAGG - Intergenic
1184630801 22:45777269-45777291 TTGTTACCATAGCTGGAGTCGGG + Intronic
1185108694 22:48888713-48888735 TTGTTTCCACAGCTGCAATCAGG - Intergenic
1185173596 22:49306971-49306993 CTCTGTGCAGAGCTGGAGCCGGG - Intergenic
1185258238 22:49848453-49848475 CTGGGTGCTGAGCTGGAGTCTGG - Intergenic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
950067297 3:10123259-10123281 CTGTTTTCACAGATGGAATGTGG + Intronic
950420362 3:12895258-12895280 CTGTTGGCAAAGCTGGAGTGTGG - Intergenic
950655300 3:14432748-14432770 CTGTTTCCACAGCCAGAGGCAGG - Intronic
951340795 3:21484422-21484444 CTATCTGCACCGCAGGAGTCTGG + Intronic
951405831 3:22296308-22296330 TGGTTTGAACAGCTGGAGGCTGG + Intronic
952840721 3:37643117-37643139 CAGATTGCACACTTGGAGTCAGG + Intronic
953176164 3:40554504-40554526 CTGTCTCCCCAGCTGGAGTGTGG + Intronic
953373833 3:42412214-42412236 GTGTTGGCTCAGCTGGAGGCTGG + Intergenic
956229520 3:66998320-66998342 CTTTTTAAATAGCTGGAGTCGGG + Exonic
956409252 3:68962034-68962056 GTGTGTGCACAGCTTAAGTCAGG + Intergenic
956706581 3:72004394-72004416 CTGGTATCACAGCTGGAGTGTGG - Intergenic
958956216 3:100467923-100467945 CGGTTTGCACAGCAAGAGTGAGG - Intergenic
960399515 3:117179246-117179268 CTGTTTCCACAGCTGCAGAATGG + Intergenic
962403263 3:135079494-135079516 GTGTTTGCACTGATGGGGTCAGG - Intronic
964511773 3:157460451-157460473 GTGTTTTCACAGCTGTACTCTGG - Intronic
968062094 3:195733362-195733384 CTGTTGCCACATCTGGGGTCAGG - Exonic
969451128 4:7274020-7274042 GTGTTTGCAAACCTAGAGTCAGG - Intronic
969688452 4:8689967-8689989 CTGGCTGCACAGGTGGAGTCTGG + Intergenic
974160471 4:58131963-58131985 CTCTTTGCAAGGCTGGAGTCTGG - Intergenic
975839012 4:78454761-78454783 CTCTTAACACAGCTGGGGTCAGG - Intronic
975856200 4:78627268-78627290 CTTTAGGCACAGCTGGATTCAGG + Intergenic
976148180 4:82064702-82064724 CTGGTTGCCCAGTTGGAGTAGGG - Intergenic
976366619 4:84240152-84240174 CTGTTTCCAAAACTGGAGTAAGG + Intergenic
978010911 4:103682773-103682795 CTGTTTTCTCATCTGGAGGCTGG + Intronic
982023398 4:151227987-151228009 CAGTCTGCACAGCTGGAATGTGG + Intronic
982270324 4:153579295-153579317 CTGTTTCCCAGGCTGGAGTCGGG - Intronic
982301249 4:153881364-153881386 CTGCTTTCACAGCTGGTGTGAGG - Intergenic
985992873 5:3577919-3577941 CAGTTTGGACAGGTGGAGGCTGG - Intergenic
990628802 5:57644336-57644358 CTGTTTGCACTCCTTGATTCTGG + Intergenic
991702906 5:69332702-69332724 CTGTTCGCTGAGCTGGAGTCCGG - Exonic
994003620 5:94811421-94811443 CTGTTTGAACAGTTGGAGTTCGG - Intronic
996087312 5:119318316-119318338 CTGTTAGCCAGGCTGGAGTCTGG + Intronic
996485395 5:124027587-124027609 CTTCTTGCACATCTGGAGACTGG - Intergenic
1000993099 5:167931228-167931250 CTGTTTGCATAGCAGGAATCAGG - Intronic
1001563725 5:172686424-172686446 CTGTATGCTCAGCTGGAGGGAGG + Intronic
1002043423 5:176529883-176529905 CTGTTTGCAAGGAGGGAGTCAGG - Intronic
1002888950 6:1317348-1317370 GTGTTTGCGCAGCTGGGGCCGGG - Intergenic
1003026032 6:2556631-2556653 CTGATAGCACATCTGGAATCAGG - Intergenic
1003181523 6:3795964-3795986 CTGCAGCCACAGCTGGAGTCTGG + Intergenic
1003545450 6:7054197-7054219 CTGTTGCCTCAGCTGGAGTGCGG - Intergenic
1004919881 6:20366623-20366645 CTGTTTGCTCTGATGGAGTGTGG - Intergenic
1005057237 6:21740942-21740964 TTGTTTGAACAGCTGTACTCCGG + Intergenic
1005337101 6:24808222-24808244 CTGTTTGCACAGCTCCAGTGAGG + Intronic
1005474508 6:26194809-26194831 CTGTTTGCATAGCTGAACTCAGG - Intergenic
1006847022 6:37069383-37069405 CTGTTTGCACATGTGCAGTGAGG - Intergenic
1007430713 6:41775158-41775180 CCTTTTGCACAGCTTAAGTCTGG + Intronic
1007721321 6:43887088-43887110 GTGTTTGCCCAGCAGGAGCCAGG + Intergenic
1007768105 6:44173113-44173135 CTGTCTGGACAGCTGGAATCAGG + Intronic
1007924172 6:45638030-45638052 CTGTTTGCACAGCAGAGCTCTGG + Intronic
1009479081 6:64133743-64133765 CTGTTTGCACTGCTGATCTCTGG + Intronic
1013904152 6:115195492-115195514 CTGCTTCCACAGCAGGAGCCTGG - Intergenic
1018039740 6:159911369-159911391 CTGTTGCCCCAGCTGGAGTGCGG + Exonic
1019485561 7:1287798-1287820 CTGTCTGCCCAGCTGGCCTCAGG + Intergenic
1019982244 7:4630139-4630161 CTGATGGCAGAGCAGGAGTCAGG - Intergenic
1020376437 7:7492546-7492568 CTGTTGCCAAAGCTGGAGTGTGG - Intronic
1024809563 7:53192027-53192049 CTGTTTGCACAGCTTCATGCTGG - Intergenic
1025245452 7:57313268-57313290 CTGCTCCCACAGCTGGAGACGGG + Intergenic
1028541855 7:91951359-91951381 CTGTTGCCCCAGCTGGAGTGTGG + Intronic
1028990653 7:97045711-97045733 CTGTTAGGTCAGCTGGAGGCTGG - Intergenic
1029195027 7:98799384-98799406 CTCTTTGCACAATTGGATTCTGG + Intergenic
1033644820 7:143292972-143292994 CTGTTGGCAAGGCTGGAGTGCGG - Intronic
1035137778 7:156722655-156722677 CTGTTTGGACAGCTGGGTCCAGG + Intronic
1035966924 8:4202900-4202922 CTGTGTGGACACCTGGAGTGAGG + Intronic
1036126623 8:6068868-6068890 CATCTTGCACAGTTGGAGTCTGG - Intergenic
1038136989 8:24796969-24796991 ATGTTTGCAGAGATGGAGTGTGG - Intergenic
1038441410 8:27573184-27573206 CTGTGAGAACAGCTGGAGTGGGG + Intergenic
1038938891 8:32282143-32282165 GAGTTTGCACAGCTGGACACAGG + Intronic
1039032558 8:33326026-33326048 CTGCTGGGACTGCTGGAGTCAGG + Intergenic
1039130877 8:34262686-34262708 CTGTTAGCACATCAGGAATCAGG + Intergenic
1040101353 8:43509857-43509879 CTGTTTAAACAGCTGAAATCTGG - Intergenic
1040497274 8:47977362-47977384 GTGTATGCACAGATGCAGTCTGG + Exonic
1043372394 8:79610526-79610548 CTTTTAGCACAGCTGGACTTAGG - Intergenic
1045531717 8:102991267-102991289 CTGTTTGCTCAAATGAAGTCTGG + Intergenic
1046833431 8:118773300-118773322 CTTTTGGCACAACTGGATTCAGG - Intergenic
1047643294 8:126843804-126843826 CAGTTTGCACAGATGGAAGCAGG - Intergenic
1048281987 8:133112467-133112489 CTGTCTGCACTGTGGGAGTCTGG - Intronic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1053482119 9:38423665-38423687 ATGTTTGCCCAGCAGGAGACTGG - Intronic
1055426396 9:76201137-76201159 CTGTTTGCAAAACTGGACTTGGG + Intronic
1056821251 9:89843641-89843663 CTCTTTTCTCAGCTGGAGGCAGG - Intergenic
1057280932 9:93711110-93711132 CTCTGTGCAGGGCTGGAGTCAGG - Intergenic
1057833684 9:98427192-98427214 CTGTTTGTAGGGCTGGAGTGAGG + Intronic
1058698882 9:107584764-107584786 CTGCCTCCACATCTGGAGTCAGG - Intergenic
1059322659 9:113481547-113481569 CTGTTTGCACAGCTGGAGTCAGG - Intronic
1060816331 9:126637428-126637450 CTGTGTGCACTGGTGCAGTCAGG + Intronic
1060992747 9:127858035-127858057 CTGTTTACACAGGTGTGGTCGGG - Intergenic
1061081601 9:128374185-128374207 CTGTCAGCACATCTGGAGTGGGG - Intronic
1061283436 9:129609910-129609932 CTGTTTGTAGGGCAGGAGTCCGG + Intronic
1061426520 9:130501848-130501870 CTGATTGGCCAGCTCGAGTCAGG - Intergenic
1061725311 9:132579317-132579339 CTGTTCCCACAGCAGGAGGCAGG - Intergenic
1062080699 9:134621910-134621932 CTGTGTGTTCAGCTGGATTCAGG + Intergenic
1186682451 X:11890242-11890264 CACTTTGCACAGCAAGAGTCTGG - Intergenic
1187651153 X:21408437-21408459 TTGTTTGCACAGCTGCTTTCAGG + Intronic
1192522741 X:71815994-71816016 CTCTTTCCAGAGCTGGAGTTTGG - Intergenic
1192615424 X:72616186-72616208 TTTTTTGCAGAGCTGGGGTCTGG - Intronic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1200155808 X:153974369-153974391 CTGGTGTCTCAGCTGGAGTCAGG + Intronic