ID: 1059323853

View in Genome Browser
Species Human (GRCh38)
Location 9:113490316-113490338
Sequence CTGGAGAAGGGGAAAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1122
Summary {0: 1, 1: 0, 2: 7, 3: 125, 4: 989}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059323853_1059323859 19 Left 1059323853 9:113490316-113490338 CCATCCACTTTCCCCTTCTCCAG 0: 1
1: 0
2: 7
3: 125
4: 989
Right 1059323859 9:113490358-113490380 TCCCAGACATCTCATCTCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059323853 Original CRISPR CTGGAGAAGGGGAAAGTGGA TGG (reversed) Intronic
900159159 1:1215350-1215372 CTGGAGAGGGAGGGAGTGGAGGG + Intergenic
900469444 1:2846085-2846107 CTGGAGAAAAGGGAAGTGCAGGG - Intergenic
900520030 1:3100970-3100992 CTGGAGGAGGGGGCATTGGAGGG + Intronic
900552692 1:3264584-3264606 CAGGAGGAGCGGAAAGGGGAGGG + Intronic
900663040 1:3795661-3795683 CAGGAGAAGGGGGAGTTGGAAGG + Intronic
900905647 1:5555263-5555285 CTGGAGAACAGGAAAGCGGGTGG + Intergenic
901146093 1:7065539-7065561 CTGGAGGAGGGGACAGGAGATGG + Intronic
901180750 1:7340288-7340310 CTGGAGAAGGTAAGACTGGAGGG + Intronic
901219586 1:7575803-7575825 CTGGGGAAGAGGAAAGCTGAGGG + Intronic
901514551 1:9736242-9736264 CTGGAGAAAGGGAGAGTTGGGGG + Intronic
901928551 1:12582762-12582784 CTGGTGAACGGGAGAGTGGACGG - Intronic
902379120 1:16044463-16044485 CTGGAGAAGCGGATAGAGGGAGG - Intronic
902385155 1:16072222-16072244 CTGGGGAAGGGGAAGGTACAGGG - Intronic
902630210 1:17700381-17700403 CTGGAGAAGGGGGATGGGAAGGG + Intergenic
902654926 1:17860530-17860552 GTGGAAAAGTGGAAAGTGAAGGG - Intergenic
902655348 1:17864071-17864093 CTGGATGAGGTGACAGTGGATGG + Intergenic
902770739 1:18644074-18644096 CTGGAAGAGGGGAAAGTGGCCGG - Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902833127 1:19030269-19030291 CTGGAGCAGGGGAGAGAGGAAGG + Intergenic
902896492 1:19484039-19484061 CTGCAGAAGGGTCAAGTGGCAGG + Intronic
902992977 1:20202583-20202605 TTGGAGAAGGGGAAGGAGAATGG - Intergenic
903036547 1:20496684-20496706 CCGGAGCAGGAGGAAGTGGAGGG - Intergenic
903127015 1:21255097-21255119 CTGGAGGAGGGTAAAGGGCAGGG + Intronic
903189268 1:21647708-21647730 CTGGGGTAGGGGAAAGAGCATGG - Intronic
903261974 1:22136398-22136420 CTGGGGTTGGGGAAAGAGGAGGG + Intronic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903368947 1:22822643-22822665 CTGGAGCAGGCAAAAGTGAAAGG + Intronic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904015103 1:27413658-27413680 CTGGACAACAGGAAAATGGAAGG + Intronic
904260806 1:29286616-29286638 CTGGAGAGGGCTATAGTGGAGGG + Intronic
904389476 1:30172499-30172521 CTAGATCAGAGGAAAGTGGATGG + Intergenic
904807272 1:33140861-33140883 AAGGAGAAGGGGAGAGAGGAGGG - Intergenic
904920139 1:34000982-34001004 GGGGAGAAGGAGAAAGGGGAAGG + Intronic
904945961 1:34198914-34198936 CTGGAGAAGAGGTAGGAGGAAGG - Intronic
905168019 1:36094516-36094538 CTGAAGAAGGGAAAATTGAAAGG + Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905293101 1:36936585-36936607 CTGGAGAATGGGAATGGGGTGGG - Intronic
905458162 1:38102754-38102776 CTGGAGGAGGGGCAACAGGAGGG + Intergenic
905486506 1:38301090-38301112 ATGGAGAAGGGGCAGGTTGAAGG + Intergenic
905799942 1:40837041-40837063 GGGGAAAAGGGGAAAGAGGATGG - Intronic
905891006 1:41518359-41518381 GCGGACAAGGGGAAAGGGGACGG + Intronic
905942436 1:41874837-41874859 CTGGAGAAGGGAAAGGTAGCTGG - Intronic
906090250 1:43172561-43172583 CCGGGGGAGGGGAAAGGGGAGGG + Exonic
906191969 1:43904746-43904768 CAGGAGGAGGGGAGAGTGGTGGG - Intronic
906197856 1:43940150-43940172 CTGGGGATAGGGAAAGGGGATGG - Intergenic
906680274 1:47721531-47721553 GTGGAGATGGGAAATGTGGATGG - Intergenic
907312032 1:53544318-53544340 CTGGAGATGGGAGAAGGGGAAGG + Intronic
907326989 1:53644698-53644720 CTGGAGAGGAGGAAATTAGAAGG + Intronic
907766117 1:57412212-57412234 CAGAGGAAGGGGAAAGTAGACGG - Intronic
908007441 1:59741374-59741396 CTGGAGCGGGAGGAAGTGGAGGG - Intronic
908077436 1:60535819-60535841 CTGGAATAGGGGCATGTGGATGG + Intergenic
908109070 1:60876687-60876709 GAGGAGATGGGGAGAGTGGATGG - Intronic
908558935 1:65285584-65285606 CTAGAGAAGGGAAAAATGGTTGG - Intronic
908629684 1:66088762-66088784 TTGGAGATGGGGGAAGAGGAGGG - Intronic
908930550 1:69312331-69312353 CTGGAGCCGGGGAGACTGGAGGG - Intergenic
908934824 1:69362656-69362678 CTGTCGAATGGGAAAGTGGGAGG - Intergenic
909172517 1:72314809-72314831 CTGGGGAAGAGGTATGTGGATGG - Intergenic
909741802 1:79038096-79038118 CTGGAGAAGGAGAAAGAGACAGG - Intergenic
909800896 1:79806192-79806214 CTGGAAGAGGGGAATATGGAGGG + Intergenic
910105939 1:83631232-83631254 GTGGAGAAGGGGCCAGAGGAAGG - Intergenic
910711808 1:90189892-90189914 CTGCAGAGAGGGAAAGAGGAGGG - Intergenic
910946655 1:92599990-92600012 CTGGAGAAAAGGAAACTGGATGG + Intronic
910948303 1:92617366-92617388 TTGGAGAAGAGGTATGTGGATGG + Intronic
911287293 1:96011524-96011546 CTGGAGAGGGTGTAAGTTGAGGG - Intergenic
911620905 1:100065670-100065692 AAGGAAAAGGGGAAAGGGGAAGG - Intronic
911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG + Intergenic
912212338 1:107569516-107569538 CTGGGGAAGAGGTATGTGGATGG + Intergenic
912501452 1:110125218-110125240 TTGGAGAAGGGGGCAGTGGGAGG + Intergenic
912801771 1:112723870-112723892 CTGGAGTAGGGGAAAGACAAGGG + Intronic
914441816 1:147714364-147714386 CTTGAGTAGGTGAAAGGGGATGG - Intergenic
914900595 1:151709192-151709214 GTGGGGAAGGGGGAAGTGGGTGG + Intronic
914965417 1:152253248-152253270 CTGGGGAAGAGGTATGTGGATGG - Intergenic
915003333 1:152613602-152613624 CTGGAAGAGGGAAAAATGGAAGG + Intergenic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915147090 1:153801690-153801712 CGGGAGCAGGGGAATGTGAAGGG - Intergenic
915338535 1:155162808-155162830 CCAGAAAAGGGGAATGTGGAAGG + Intergenic
915393123 1:155562313-155562335 GAGGAGAAGGGAAAGGTGGAAGG + Exonic
915409278 1:155688219-155688241 GAGGAGAAGGGAAAGGTGGAGGG + Exonic
915488654 1:156239469-156239491 CTGGAGTCAGGGACAGTGGAGGG + Intronic
915536096 1:156536475-156536497 TAGGAGAAGGGGAGAGAGGATGG + Intronic
915555342 1:156657970-156657992 CCGGGGAAGGGGAAAGGAGAGGG - Intronic
915595441 1:156894007-156894029 GAGGGGAAGGGGACAGTGGAGGG + Intronic
916005427 1:160655065-160655087 ATGGAGAAGAGGCAAGTGGATGG - Intergenic
916242913 1:162657796-162657818 GAGGAGAAGGGAAAAGAGGAAGG - Intronic
916790831 1:168123683-168123705 CAGGAGAAAGGGAAAGGAGAAGG - Intronic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
917621523 1:176801410-176801432 CTGGAGAGGGGGAAAGGGTGGGG + Intronic
917626800 1:176854458-176854480 CTAGAGTAGGGCAAAGTGGGGGG - Intergenic
917726928 1:177837071-177837093 CTGAAGATGGGGAAAGAGGGAGG + Intergenic
917764620 1:178202667-178202689 CTGGGGAAGAGGTATGTGGATGG + Intronic
917846385 1:179024038-179024060 ATGGAGAAGGGAAAACTGGGGGG + Intergenic
918006824 1:180548991-180549013 CAGGAGGAGTTGAAAGTGGATGG - Intergenic
919090748 1:192976685-192976707 CTGGGGAAGGGGAATGTCAAAGG - Intergenic
919093549 1:193002159-193002181 CTGGAGAACAGGAAAGTGGGAGG + Intergenic
919241860 1:194924860-194924882 TTGGAGAAGAGGTATGTGGATGG + Intergenic
919725637 1:200881152-200881174 GTGGAGAAGGGTTAAGAGGATGG - Intergenic
920006304 1:202836014-202836036 CTGGAGATGGAGAGAGGGGAAGG - Intergenic
920268872 1:204747782-204747804 CTGCAGAAGAGGAGAGGGGATGG + Intergenic
920297341 1:204967118-204967140 CAGGACAAGGGAAAGGTGGAGGG - Intronic
920312729 1:205058158-205058180 CTGCAGCAGGGGACAGAGGAAGG - Intronic
920605759 1:207383165-207383187 CTGGAGTAGGCAAGAGTGGATGG - Intergenic
920682797 1:208085410-208085432 CAGGAGAAGGGGACAGAGAAAGG - Intronic
920775928 1:208937100-208937122 CTTTAGAAGGGTAAAGTGCAAGG + Intergenic
920837421 1:209524565-209524587 CTGGAGGCTGGGAGAGTGGAGGG + Intergenic
920971480 1:210746909-210746931 CTGCAGAATGGGACAGAGGAAGG + Intronic
921470592 1:215543516-215543538 CTGGAGGAGGGGCAAGTGCATGG + Intergenic
922157986 1:223054758-223054780 CTGGAGAGTGGGAAAGTGAATGG - Intergenic
922170450 1:223150141-223150163 GTGGAGAAAGGGAAAGCAGAAGG - Intergenic
922207342 1:223459979-223460001 CTGGGGAAGAGGAAACTGCAAGG - Intergenic
922343436 1:224676288-224676310 CTGGAGAAGGCAAAACTAGAGGG + Intronic
922520100 1:226242790-226242812 GAGGAGAAGGAGGAAGTGGAGGG - Intronic
922597420 1:226824582-226824604 CAGGAGATGAGGAATGTGGATGG - Intergenic
922625826 1:227041293-227041315 CTAGAGAAGGGGAAGGAGGGAGG - Intronic
923119794 1:230979136-230979158 CAGGGGAAGGGGAACGTGGATGG + Exonic
923576314 1:235161904-235161926 TTGCAGAAGGGGAAAGAGGAGGG - Intronic
924190441 1:241546143-241546165 CAGGAGAAGGGCAAACTGGAAGG - Intronic
924338163 1:243003613-243003635 CTGGAGAAAAGGACAGTGAATGG + Intergenic
924447051 1:244142856-244142878 CAGGAGATAGGGAAAGAGGAAGG - Intergenic
924609237 1:245560094-245560116 CTGGAGAAGGGACAAGAGGAAGG - Intronic
1062764468 10:50138-50160 CTGGAGAAGGAGAAAATTGCTGG + Intergenic
1062818514 10:517183-517205 ATGGAGAAGGGAAAAGGAGAAGG - Intronic
1063768380 10:9169168-9169190 GTGGGGAAAGGGAAAGTGGGAGG + Intergenic
1064105921 10:12501070-12501092 GTGGAGTACGGGAAAGGGGATGG - Intronic
1064457086 10:15497829-15497851 TTGGAGAAGGAGGGAGTGGATGG + Intergenic
1064533026 10:16329545-16329567 AAGGAGAAGGGGAAAGGGAAGGG + Intergenic
1065328665 10:24571636-24571658 CTGCAGAAGGTGGAGGTGGAAGG - Intergenic
1065468761 10:26054608-26054630 CTGGAGAAGGGGAAATTATCCGG + Intronic
1065695580 10:28376681-28376703 CAGGAGAAGGGGGCAGTGGGTGG + Intergenic
1065883579 10:30058681-30058703 CTGGAGACGGGGGAAGTAGAGGG + Intronic
1066076291 10:31881032-31881054 ATGGAGGAGGGGAAGGTGGGGGG - Intronic
1066252765 10:33650320-33650342 CTGGAGCAGGAGGAAGTGGGTGG + Intergenic
1066277659 10:33884722-33884744 ATGGAGAAGAGAGAAGTGGATGG - Intergenic
1066393299 10:34996119-34996141 CTGGTGGTGGGGAATGTGGAGGG + Intergenic
1066594833 10:37038893-37038915 GTGGGGTAGGGGAAAGGGGAAGG - Intergenic
1067056203 10:43053100-43053122 CTAGAGGAGAGGAAGGTGGAGGG - Intergenic
1067713622 10:48670788-48670810 CTGGTGGAGGGGAAGGTGAAGGG - Intergenic
1068340760 10:55699318-55699340 TTGGAGAAGGGCCTAGTGGAAGG + Intergenic
1068765033 10:60753478-60753500 CTGGAGCAGGAGGCAGTGGAAGG - Intergenic
1069020787 10:63486101-63486123 GTGGAGAAGGGGAAAGTAAAGGG + Intergenic
1069138195 10:64791454-64791476 CTGGAAAAGGAGAAAATGGCAGG + Intergenic
1069304997 10:66957990-66958012 CTGGAGCAGGGTACAGAGGAAGG + Intronic
1069370924 10:67746940-67746962 CTGGTGCTGGGGAAACTGGATGG + Intergenic
1069607103 10:69746455-69746477 CGGAAGAAGGGTAAAGTGAAAGG + Intergenic
1069633398 10:69911191-69911213 ATTGAGAAGGGGCAAGGGGAAGG - Intronic
1069711465 10:70491745-70491767 CTGGGGGAGGGGAAACTGGGAGG - Intronic
1070282086 10:75057371-75057393 CTGGAGTCCGGGAGAGTGGAGGG + Intronic
1070688238 10:78505668-78505690 CTGGAGAAGGAGACAGGGCAGGG + Intergenic
1070844158 10:79508151-79508173 CTGGAGGAGGGAAAGGTGCAAGG - Intergenic
1070855162 10:79602903-79602925 CTGGAAAAGGGGGCAGGGGAAGG + Intergenic
1070921968 10:80193359-80193381 CTGGAGAAAGGGAAAGAGGAAGG + Intronic
1070929639 10:80252160-80252182 CTGGAGGAGGGAAAGGTGCAAGG + Intergenic
1071030277 10:81171736-81171758 CTGGAAAAGGTGAAAAAGGAAGG + Intergenic
1071663003 10:87524736-87524758 CTGGAGGAGAGGAAAGAGGATGG + Intronic
1072843947 10:98807335-98807357 CTGGATAGGTGGGAAGTGGATGG - Intronic
1072916528 10:99540506-99540528 CGACAGAAGGGGAAGGTGGAAGG + Intergenic
1073051158 10:100668217-100668239 CGGGAGGAGGGGTAAGAGGATGG - Intergenic
1073065152 10:100754113-100754135 CTGGAGAGGGGAGAGGTGGAGGG + Intronic
1073077708 10:100835113-100835135 TTGGAGAAGGGAGATGTGGATGG - Intergenic
1073472200 10:103729806-103729828 CTGGAAATGGGGAAACTGGCAGG - Intronic
1073479922 10:103779937-103779959 CTGAAGAAGGGGGAAGGGGAAGG + Intronic
1073592141 10:104767654-104767676 GTGGAGAAGGGGAAGGGGAACGG - Intronic
1073612519 10:104958517-104958539 CTAGAGAATGGGAAAGAGGGAGG + Intronic
1073898192 10:108187045-108187067 CTGGAGCAGGGGAAAAGGGGAGG - Intergenic
1073918387 10:108431672-108431694 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1074105060 10:110383155-110383177 CTGGAGATGGGGAATGTGTCAGG + Intergenic
1074124056 10:110514269-110514291 CTGGAGAAGGGGATTGTGTGGGG - Intergenic
1074284302 10:112083513-112083535 CTGCAGAAGAGGAAAATGGGAGG - Intergenic
1074689953 10:115995275-115995297 CTGGTGGAGGGGTAAGTGGACGG + Intergenic
1074844881 10:117388981-117389003 CGGGGAAAGGGGAAAGTGAAGGG - Intergenic
1075011559 10:118874733-118874755 CTGAAACAGGGGAATGTGGATGG + Intergenic
1075065836 10:119288299-119288321 CAGGGGGAGGAGAAAGTGGAGGG + Intronic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075212610 10:120503689-120503711 CTGGGGAAGGGGAAAGAGACAGG - Intronic
1075378241 10:121996987-121997009 CTGGAGAAGGAGAAAGAGAGTGG + Intronic
1075425368 10:122337939-122337961 CCCCAGAAGGGGAAAGAGGAAGG - Intronic
1076136235 10:128047058-128047080 CTGGAGAAGGGTGAAGGGGCCGG - Intronic
1076143962 10:128102147-128102169 CTTGAGAAGGGGAAACTGTCTGG - Intronic
1076150892 10:128161252-128161274 CTGCAGAAGAGTAAAGAGGAAGG - Intergenic
1076498585 10:130916205-130916227 CTGGAGCAGAGGAAACTAGAAGG + Intergenic
1077078018 11:709948-709970 CTGGGGAAGGGCAGAGTGGGGGG - Intronic
1077166753 11:1145152-1145174 CTGGAGACTGGGAGAGGGGACGG + Intergenic
1077174236 11:1181426-1181448 GTGGAGAAGGAGAAGGTGGTTGG - Intronic
1077249468 11:1554615-1554637 CTGCAGAAGGGACAAGGGGAAGG + Exonic
1077922591 11:6652881-6652903 GGAGAGAAGGAGAAAGTGGATGG - Intronic
1078967081 11:16358271-16358293 CAGGAGAATGGCAGAGTGGAAGG - Intronic
1079089016 11:17467774-17467796 CTAGAACAGGGAAAAGTGGAGGG - Intronic
1079387319 11:19992084-19992106 TAGGAGAAGAGGAAAGGGGATGG - Intronic
1079615358 11:22486108-22486130 AAGGAGAAGGAGAAAGTGCAAGG + Intergenic
1079709797 11:23666771-23666793 CTGGGGTAGGGGTAAGTGAAAGG - Intergenic
1079754249 11:24235400-24235422 TTGGAGAAGGGGTGAGTGAAGGG - Intergenic
1080033810 11:27689872-27689894 CTGGAGCAGGGGGCAGGGGAAGG - Intronic
1080257483 11:30307169-30307191 GGGGAGAAGGGGCAAGGGGAGGG - Intergenic
1080749282 11:35138149-35138171 GTGGAGAAGAGGATGGTGGATGG + Intergenic
1081510756 11:43770482-43770504 CTTGAGAAGGCCAAAGTGGGAGG + Intronic
1081540001 11:44027565-44027587 CTGAAAAAGGGGAAAGAAGAAGG - Intergenic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1081731717 11:45376443-45376465 GGGGAGCAGGGGAAAGAGGAGGG - Intergenic
1081745935 11:45472422-45472444 CTGGGAGAGGGGAAAATGGAGGG + Intergenic
1083068043 11:59945938-59945960 CTGGAGCAGGAGGAAGTGGTCGG + Intergenic
1083181531 11:60988915-60988937 CTGGAGGAGGGGAGTGAGGAGGG - Intronic
1083201199 11:61122032-61122054 ATGGAGACAGGGAAATTGGAAGG + Intronic
1083248848 11:61451816-61451838 CTGAAGAAGGGATAAGTGAATGG + Intronic
1083684386 11:64368016-64368038 CTGGACAAGGGGGCAGTGGGGGG - Intronic
1083887277 11:65579055-65579077 CTGGGGGAGGGGGAAGGGGAGGG - Intronic
1084753594 11:71220764-71220786 CTGGGGAAGAGGAATGGGGAGGG + Intronic
1084949590 11:72657327-72657349 TGGGAGGAGGGGAAAGAGGAGGG + Intronic
1085051541 11:73382604-73382626 CTGGAGTAGGGGCAACTGGCAGG - Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085199659 11:74694117-74694139 CTGGAGGAGGAGATAGAGGAGGG - Intergenic
1085369363 11:75984648-75984670 CTGGAGATGTGGTAAATGGAAGG - Intronic
1085409623 11:76283412-76283434 GAGGAGAAGGGGGAAGGGGAGGG + Intergenic
1085498527 11:76995177-76995199 GTGAAGGAGGGGCAAGTGGAAGG - Intronic
1085703397 11:78764797-78764819 CTGGAGAAGAAGGAAGTAGAAGG + Intronic
1086078880 11:82882122-82882144 CAGGAGGAGGAGAAAGAGGAGGG + Intronic
1086278698 11:85161084-85161106 CTGGGGAAGGGGTATGTGGATGG + Intronic
1086426058 11:86683323-86683345 CAGGATGAGGGGAAAGAGGAAGG + Intergenic
1086474085 11:87151740-87151762 CACGAGAATGGGAAAGTGGTTGG + Intronic
1086490657 11:87355122-87355144 CATGAGACGGGGAAGGTGGATGG - Intergenic
1086805544 11:91237101-91237123 TGGGACAAGGGCAAAGTGGAGGG + Intergenic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087423915 11:97966390-97966412 CTAGAGAAGGGAAAAGAGAAGGG + Intergenic
1087959286 11:104327689-104327711 CAGGAGAAGGGGAAAATACAGGG + Intergenic
1088180606 11:107104657-107104679 CTGGAGCAGGAGAAAGGGGGAGG + Intergenic
1089407041 11:118206318-118206340 CTGGAAAAGGGGAAAGAGAAAGG - Intronic
1089629142 11:119773035-119773057 CAGGGGAAGTGGAAAGAGGAGGG - Intergenic
1089710120 11:120308487-120308509 TAGGAGTAGGGGAAAGTGGCCGG + Intronic
1089847221 11:121467712-121467734 CTGGAGAGGAGGAAAAGGGAAGG + Intronic
1090029315 11:123194368-123194390 AAGGAAAAGGGGAAAGGGGAAGG - Intronic
1090119112 11:124005762-124005784 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090696898 11:129254383-129254405 GTGGAGAATGGGAAGGAGGAAGG - Intronic
1090982147 11:131732520-131732542 TTTCAGAAGGGGAAATTGGAAGG + Intronic
1091196155 11:133732607-133732629 CTGGACAAGGGGCAGGGGGATGG - Intergenic
1091314921 11:134607837-134607859 CTGGAGCAGAGGAAAGTCCATGG - Intergenic
1091348878 11:134876870-134876892 GTGGAGAGGGGGCATGTGGAGGG - Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091662286 12:2393365-2393387 CTGGAGCAGGAGATGGTGGAGGG - Intronic
1091848615 12:3677577-3677599 CTGGAGAAGGGGGAAGGAGAAGG - Intronic
1092059173 12:5534659-5534681 CTGGAGATGGGGGTAGTGGTAGG - Intronic
1092140781 12:6182082-6182104 CTGGAGGAAGGGACAGGGGATGG + Intergenic
1092527707 12:9319284-9319306 CTGGAGAATGGGAAATGGAAAGG - Intergenic
1092539550 12:9412473-9412495 CTGGAGAATGGGAAATGGAAAGG + Intergenic
1092654324 12:10668730-10668752 CTGGAGAAAGTGAAAGTAGAAGG - Intronic
1092672913 12:10883431-10883453 CTATAGAGGAGGAAAGTGGAGGG - Intronic
1092672971 12:10884076-10884098 CTATAGAGGAGGAAAGTGGAGGG - Intronic
1092676752 12:10929393-10929415 CTATAGAGGGGGAAAGTGGAGGG + Intronic
1092846905 12:12592037-12592059 CAGGAGAAGTAGAAAGTGGCTGG - Intergenic
1093036431 12:14336312-14336334 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1093156913 12:15697108-15697130 CTGAAGAAGGGAAAACTTGAGGG + Intronic
1093156921 12:15697167-15697189 CTGAAGAAGGGAAAACTTGAGGG + Intronic
1093225881 12:16482722-16482744 CTGGAGAAGGGAAAAGATAATGG + Intronic
1093623483 12:21320159-21320181 CTGGAGGTGTGGAAGGTGGAAGG - Intronic
1094162147 12:27402752-27402774 CTGGAGAGGGGAAAATTTGAAGG + Intronic
1094185860 12:27642001-27642023 ATGGTGAAGGGAAAAGTAGATGG + Intronic
1094523699 12:31218390-31218412 AAGGACAAGGGGAAAGGGGAAGG + Intergenic
1094524749 12:31224031-31224053 CTGGAGAATGGGAAATGGAAAGG - Intergenic
1094772749 12:33684479-33684501 AGGGAGAAGGGGAAGGGGGAGGG - Intergenic
1094814260 12:34167847-34167869 CTGGAGAAGGAGAAAATTGTTGG + Intergenic
1095102664 12:38200743-38200765 CTGGAGAAGGAGAAAATTGCTGG - Intergenic
1095158640 12:38889493-38889515 GTGGAGAAGGGGAGGGTGGTGGG + Intronic
1095575665 12:43735375-43735397 CTGGACAAGGAGGAAATGGAAGG + Intronic
1095822398 12:46492675-46492697 CTTGAAATGGGGAAAGAGGAAGG + Intergenic
1095844299 12:46729342-46729364 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1095889378 12:47221803-47221825 CTAGAGAAGTGGGAAGTGGCTGG + Intronic
1095954809 12:47799874-47799896 CTGGAGAAGGGGAAGTGGGTGGG + Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096220476 12:49825847-49825869 CAGGTGAAGGGGAATGTTGAAGG - Intronic
1096553398 12:52388951-52388973 CTGGTGGAGGTGAAAGGGGAAGG + Intergenic
1096745588 12:53724864-53724886 CAAGAGAAAGGGAAAGTGGAGGG + Intronic
1097161071 12:57047139-57047161 CTAGAGAAGGGAAAGGAGGAAGG + Intronic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1098031539 12:66259770-66259792 CTGGTCAAGGGGAAAGTGGTAGG - Intergenic
1098831817 12:75373397-75373419 TTGGAGAAGAGGTATGTGGATGG - Intronic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100239106 12:92692694-92692716 GTGGGGAAGGGAAAAATGGAAGG + Intergenic
1100659355 12:96679870-96679892 CTGGACAAGAGGAAAGTGAAAGG - Intronic
1101037017 12:100716556-100716578 ATGAAGCAGGGGAAAGAGGAAGG - Intergenic
1101189291 12:102314539-102314561 CTACAAAAGGGAAAAGTGGAGGG + Intergenic
1101315511 12:103625318-103625340 GTGGAGAAAGGGCAAGTGAAAGG + Intronic
1101829522 12:108246510-108246532 GTGCAGAAGGGGAACCTGGATGG - Intronic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102162292 12:110779278-110779300 CTAGAGGAGGGGAAAAGGGAGGG + Intergenic
1102208870 12:111109723-111109745 GTGGAGAAGGGGAAAGGCAATGG + Intronic
1102796668 12:115695000-115695022 AGGCAGAATGGGAAAGTGGAAGG - Intergenic
1102810274 12:115818410-115818432 CTTGAGAAGAGGAGAGAGGAAGG - Intergenic
1102991572 12:117319994-117320016 CTGGTGAGAGGTAAAGTGGAAGG + Intronic
1103070514 12:117937360-117937382 CTTGAGAAGGGTAGGGTGGAGGG - Intronic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1103562487 12:121799957-121799979 CTGGAGGAGAGGAAGGTGGAGGG + Intronic
1103613553 12:122138401-122138423 CTGCAGAAGGGGCAGGTGGCTGG - Intronic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1103996780 12:124835150-124835172 GTGGAAAAGGGGAAAGTGTATGG + Intronic
1104356377 12:128090242-128090264 GTGGAAAAGGGGACAGTGGTTGG + Intergenic
1105264960 13:18807880-18807902 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1105273980 13:18904210-18904232 CGGGAGAGGGGAAAAGAGGATGG - Intergenic
1105722873 13:23134511-23134533 CTGGAAAAGGAGGAAGAGGAGGG + Intergenic
1105775469 13:23655457-23655479 CTGAAGAAGTGGAAATAGGAAGG - Intronic
1105949178 13:25214074-25214096 CTGGAGCAGGTGACAGTAGATGG - Intergenic
1105985858 13:25566522-25566544 ATGGAAAAGGAGAAAGTGGCAGG + Intronic
1106283527 13:28298569-28298591 GTGGAAAAGGGGAAAATTGATGG + Intergenic
1106389644 13:29322619-29322641 CGGGTGAAGGGGAAACTGGCAGG + Intronic
1107036121 13:35904568-35904590 AGGGAGATGGGGAAAGTGGTGGG + Intronic
1107440741 13:40425387-40425409 CTGGAGCAGGGTGAGGTGGAGGG - Intergenic
1107889425 13:44901339-44901361 GAGGAGAAGGGGAAAGAGAATGG + Intergenic
1109181898 13:59223889-59223911 CAGGAGAAGGGGAGAAGGGAAGG + Intergenic
1109267703 13:60219988-60220010 TTGGAGAAAGTGAAAGTGAAGGG + Intergenic
1110380145 13:74841056-74841078 CTGGAAAAGGGGTAAGTTTAAGG - Intergenic
1110788358 13:79560185-79560207 AGGGGGAAGGGGGAAGTGGAGGG - Intergenic
1110873992 13:80487257-80487279 CTGGAGAAGATAAATGTGGATGG + Intergenic
1110932779 13:81243457-81243479 ATAGGGAAGGGGAAAGTGGTAGG - Intergenic
1111057711 13:82972392-82972414 TTGGGGAAGGGGTATGTGGATGG - Intergenic
1111091324 13:83452020-83452042 CTGGTGAGGGGCAGAGTGGATGG - Intergenic
1111399970 13:87721391-87721413 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1111899927 13:94188277-94188299 GTGCAGAAGGGGAAAGTGCTTGG - Intronic
1112118059 13:96379069-96379091 GTGGAGAAATGGAAAGAGGATGG - Intronic
1112491675 13:99871166-99871188 CTGGAGAGGGGGGAAAGGGAGGG + Intronic
1112765482 13:102737525-102737547 CAGGAGCAAGGGAAAGAGGACGG - Exonic
1113314028 13:109159774-109159796 CTGGAGAAGGAGAGAGAGGCTGG + Intronic
1113382179 13:109813990-109814012 CTGGAAGAAGGGAAAGGGGAGGG + Intergenic
1113677235 13:112215260-112215282 CTGGAGAGGAGGGAAGTGGGGGG + Intergenic
1114226446 14:20742976-20742998 CTTGAGAAGGTCAAAGTGGGAGG - Intronic
1114483008 14:23047123-23047145 CTGGGGAAGGGGAAAGAGGGAGG - Exonic
1114524281 14:23358832-23358854 CTAGAGAAGGGGACAGGGGAGGG - Intronic
1114980421 14:28157649-28157671 CTGGATGAGGGGAACGTGGTGGG + Intergenic
1115366093 14:32558800-32558822 CACAAGAAGGGGAAAATGGAGGG + Intronic
1116043483 14:39714677-39714699 GTGGAGAAGGGCAATGTGAAAGG - Intergenic
1116531374 14:45977607-45977629 TTGGAGAAGAGGCATGTGGATGG - Intergenic
1116885228 14:50214203-50214225 TTGGGGAATGGGGAAGTGGAAGG + Intronic
1117069442 14:52043474-52043496 GGGGAGAAGGGGACAGAGGAGGG + Intronic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117634218 14:57725006-57725028 CTGGGGAAGAGATAAGTGGATGG + Intronic
1117730800 14:58719991-58720013 ATGGAGAAGGCAAAAATGGAAGG + Intergenic
1118723412 14:68609751-68609773 CTGGAGAAGAGGAAGGTGAAAGG - Intronic
1119543610 14:75456525-75456547 CTGGAGCAGGGGAAAGCAGGTGG - Intronic
1119842769 14:77805710-77805732 CGAGTGAAGGGGAAAGTGGTAGG + Intronic
1120255005 14:82107378-82107400 CTGGAGAGATGGAAAGTGGGAGG + Intergenic
1120498327 14:85262952-85262974 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1121019793 14:90572972-90572994 AAGGAGAAGGGGAAAGTGATGGG - Intronic
1121103464 14:91265100-91265122 CTGGAGAAGGGCAAGGAGGGAGG + Intergenic
1121123766 14:91392982-91393004 CTGGGGAAGGAGAAACTGCAAGG + Intronic
1121171712 14:91859906-91859928 CTAAAGGAGGGGAAAGTGGTAGG + Intronic
1121325432 14:93016920-93016942 CTGGAGATGGGGCAGGAGGAGGG + Intronic
1121546688 14:94768519-94768541 CCGGAGAAGAGGGAAGAGGAAGG - Exonic
1121714738 14:96065566-96065588 AGAGAGAAGGGGAAAGTGGTGGG - Intronic
1121729247 14:96174836-96174858 CTGGAGAGGGGGAGAGGGAAAGG + Intergenic
1121777056 14:96598081-96598103 AGGGAGAAGGGGGAAGAGGAGGG - Intergenic
1121891533 14:97596577-97596599 CTGGAAAAGGGGATACAGGAGGG + Intergenic
1122059022 14:99124412-99124434 GTGGAGAAGGGGAAGGTGCATGG - Intergenic
1122098253 14:99386986-99387008 ATGGACAAGGGGAGACTGGAAGG + Intergenic
1122503978 14:102219905-102219927 GTGGAGAGTGGGACAGTGGAGGG + Intronic
1122636066 14:103130254-103130276 CTGGACAAGGGGGCAGGGGACGG - Intronic
1122719003 14:103711889-103711911 CAGGACATGGGGAAACTGGAAGG + Exonic
1123150212 14:106174493-106174515 CTGGACAAGGGCATAGTGGTTGG - Intergenic
1202833504 14_GL000009v2_random:60234-60256 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1123787497 15:23687539-23687561 CTGGAGAAGGGGCCAGTTTAAGG + Intergenic
1125616473 15:41018502-41018524 GTGGGGAAGGGAGAAGTGGATGG + Intronic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1126834516 15:52646208-52646230 CTGGAGAAATAAAAAGTGGACGG + Intronic
1126932644 15:53671966-53671988 GGGGAGAAGGGGAAAGAGGGAGG + Intronic
1127953991 15:63836483-63836505 TTGGAGATGGGAAGAGTGGATGG + Intergenic
1128548343 15:68582011-68582033 GTGGAGAAGAGGAAAGCAGATGG + Intronic
1128797988 15:70478818-70478840 CTGGAGAACGGGACAGAGGAGGG + Intergenic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129651809 15:77496439-77496461 ATGGAAAAGGAGAAACTGGATGG - Intergenic
1129741640 15:77992384-77992406 CTGGAGCAGGGGGAGGTGGCGGG + Intronic
1129934297 15:79436874-79436896 CTGAAGTTGGGGACAGTGGAGGG - Intronic
1130333196 15:82937270-82937292 TTTGAGAAGGGGAAAGCTGAAGG - Intronic
1130542724 15:84833484-84833506 CTGGAGAGGTGGAAGGTGGATGG + Intronic
1130608520 15:85339269-85339291 CTTGAGAATAGGAAAGTGAAAGG - Intergenic
1130766614 15:86877534-86877556 CTGGGGAAGGGATAAGTAGAAGG + Intronic
1131177240 15:90217744-90217766 CTGGGGAATGAGAAAGGGGAAGG - Intronic
1131669160 15:94600739-94600761 CTGGAGGAGGGGGAAGGAGAAGG - Intergenic
1131670524 15:94614974-94614996 CTGGACAAGAAGAAAGGGGAGGG - Intergenic
1131948402 15:97652858-97652880 CAGGTGAACGGGGAAGTGGAAGG + Intergenic
1132296176 15:100736387-100736409 CTGGGGACGGGGAATGGGGATGG - Intergenic
1133039434 16:3052541-3052563 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133043277 16:3072174-3072196 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133299964 16:4776433-4776455 CTGGGGCAGGGGAATGAGGAAGG + Intergenic
1134100398 16:11447880-11447902 CTAGAGAAGGGGAAACTTGCAGG + Intronic
1134295235 16:12939686-12939708 CAGGTGATGGGGAAAGAGGAAGG - Intronic
1134327407 16:13219647-13219669 CTGGGGCATGGGGAAGTGGAGGG + Intronic
1134330670 16:13248353-13248375 TTGGAGAAGGGGGAAGGAGAAGG - Intergenic
1134398663 16:13889078-13889100 CCGGAGAAGGAGAAAGGGGAGGG - Intergenic
1134411016 16:14003363-14003385 CAGGAGCAGAGGGAAGTGGAAGG - Intergenic
1134425621 16:14141107-14141129 CCGGAGATGGAGAAAGTGGGAGG - Intronic
1134770602 16:16806044-16806066 AAGGAGAAGGGGGAAGGGGAAGG - Intergenic
1135166425 16:20143050-20143072 AGGGAGTGGGGGAAAGTGGAAGG + Intergenic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135817232 16:25645868-25645890 TTGGACAAGGGGTGAGTGGAAGG - Intergenic
1136079509 16:27842528-27842550 CTAGAGAAGGGCACAGAGGAAGG - Intronic
1136367220 16:29814345-29814367 CTGCAGCAGGGGGACGTGGACGG + Exonic
1136598422 16:31267397-31267419 TAAGAGAAGGGGAAAGTGGAGGG - Intronic
1136679840 16:31952295-31952317 CTGGACAAGGGCATAGTGGATGG + Intergenic
1136890221 16:33965806-33965828 CTGGACAAGGGCATAGTGGATGG - Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137549189 16:49425266-49425288 GTGGGGAAGGGGACAGTGGCTGG - Intergenic
1137550454 16:49434005-49434027 CTAGAGACGATGAAAGTGGAAGG + Intergenic
1138279051 16:55759091-55759113 CTGGGGAAGGGGAAAGAGACGGG - Intergenic
1138289489 16:55834590-55834612 CTGGGGAAGGGGAAAGAGACGGG + Intergenic
1138293438 16:55867471-55867493 CTGGAGAACTGGAAAATGGAGGG - Intronic
1138519891 16:57564999-57565021 CAGGAGAAGGGCTGAGTGGAGGG - Intronic
1138761063 16:59544925-59544947 TTGGAGAAGGTGAAATTAGAAGG + Intergenic
1139364135 16:66423283-66423305 ATGCAGATGGGGTAAGTGGATGG + Intergenic
1139422206 16:66855786-66855808 GGGGAGAAAGGGACAGTGGAGGG + Intronic
1139624998 16:68180642-68180664 GTGGGGTGGGGGAAAGTGGAAGG - Intronic
1139911197 16:70398648-70398670 CTGCAGCAGGGGACAGTGGCAGG + Exonic
1139968248 16:70757474-70757496 CTGGAGAAGGGAAGACGGGAGGG + Intronic
1140024101 16:71267886-71267908 CTGCATAAGGAGAAAGTGTAAGG + Intergenic
1140118198 16:72060935-72060957 CTGGAAGAGGGCAAAGTGGACGG + Exonic
1140120231 16:72077126-72077148 CTGGAAGAGGGCAAAGTGGACGG + Exonic
1140279763 16:73543827-73543849 CTGGAGAAGGGGGTGGGGGAGGG + Intergenic
1140894947 16:79316746-79316768 CTGGAGATAGGGACAGAGGAAGG + Intergenic
1141068813 16:80934862-80934884 TTGGAGATGGGGAAAGGAGATGG + Intergenic
1141428320 16:83957617-83957639 CTGGAGTGGGGGAGAGGGGAAGG - Intronic
1141535384 16:84676248-84676270 CTGGAGAAGAGACATGTGGATGG + Intergenic
1141599084 16:85114399-85114421 TTGGAGGAGGGGAAAGGGCAGGG - Intergenic
1141847578 16:86621501-86621523 TAGGAGAAAGGGAAAGAGGAAGG - Intergenic
1141856484 16:86684760-86684782 CTGGAGACGGGGAGAGTGGGGGG - Intergenic
1141869355 16:86774076-86774098 CTGGAGAATGGGAAAGTGAGTGG + Intergenic
1141890301 16:86922072-86922094 CTGGGGAAGGAGGAAGGGGAAGG + Intergenic
1142128477 16:88421596-88421618 CTGGGGCAGAGGAAAGGGGATGG + Intergenic
1142234513 16:88915448-88915470 GTGGAGGAGGGGAGAGTGGAGGG + Intronic
1142234547 16:88915548-88915570 GTGGACAGGGGGAGAGTGGACGG + Intronic
1142440183 16:90093107-90093129 CTGGAGAAGGAGAAAATTGCTGG - Intergenic
1203082810 16_KI270728v1_random:1157808-1157830 CTGGACAAGGGCATAGTGGATGG + Intergenic
1143381377 17:6498369-6498391 CAGGAAGAGGGGAAAGTGGTCGG + Intronic
1143445204 17:7005234-7005256 CTGGAGAGGAGGAGATTGGAGGG - Intronic
1143481201 17:7228169-7228191 CTAGAGAAGGTGAGGGTGGAAGG + Intronic
1143523943 17:7461973-7461995 AGGGAGAAGGGGAAAGGGCAGGG - Exonic
1143591827 17:7889585-7889607 GTGGGGAAGGGGCAAGTTGAGGG + Intronic
1143747293 17:9003646-9003668 CTGGAGATGGGGAAAGCGAGGGG - Intergenic
1143891335 17:10104780-10104802 GTGGAGAAGGAAAATGTGGATGG - Intronic
1144427263 17:15155115-15155137 CAGGAGAGAGGGAAAGTGGGAGG - Intergenic
1144620700 17:16816679-16816701 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1144674051 17:17150517-17150539 CTGGAGTTGGGGCAATTGGAAGG + Intronic
1144755255 17:17676302-17676324 CTGGAATAGGAGAAAGTGGAGGG - Intergenic
1144884942 17:18451468-18451490 CAGGAGAAGGAAAAAGGGGAGGG - Intergenic
1145147279 17:20492909-20492931 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1146032372 17:29377205-29377227 TTGGAGAATGGGAGATTGGAAGG - Intergenic
1146280268 17:31540130-31540152 CTAGAGAGGGGGATAGTGGAGGG + Intergenic
1146531506 17:33611171-33611193 CAGGAGAGGGGGAAAGGGAAGGG - Intronic
1146533589 17:33631056-33631078 CTGGGTAAGGAGCAAGTGGAAGG + Intronic
1147250391 17:39149750-39149772 CTGGGGAAGGGGGAATTGGGAGG - Intronic
1147572089 17:41577577-41577599 CAGGAGAAGGACAAAGGGGAGGG + Intergenic
1147871781 17:43592594-43592616 CTAGAGATGGGGAGAGTGGCTGG - Intergenic
1147904234 17:43812721-43812743 CTGGAGAAGAGGTACCTGGATGG - Intronic
1147924693 17:43939091-43939113 GTGGAGTGGGGGAAGGTGGATGG - Intergenic
1148443234 17:47722483-47722505 CTGGAGAAAGGCAAGATGGAAGG - Intergenic
1148462197 17:47845285-47845307 GTGGAGAGGGGGAAAGAGGAAGG - Exonic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1148489135 17:48012117-48012139 CTGCAAAAGGGGAAAAGGGAGGG - Intergenic
1148550179 17:48545472-48545494 CTGGGGAAGGGGAGAAGGGAAGG - Intergenic
1148770709 17:50064395-50064417 CTGGAGAAGGGGAGTTGGGAGGG + Intronic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149389500 17:56174791-56174813 CTGGGGGAGGGGAAAGATGAAGG - Intronic
1149586426 17:57790744-57790766 GTGGAGAAGAAGAAAGTGGGTGG - Intergenic
1149626629 17:58084256-58084278 CTGGAGGATGGGATAGTGGAGGG + Intronic
1150592835 17:66578378-66578400 TTGGCGAAGGATAAAGTGGAAGG + Intronic
1150636257 17:66915315-66915337 CTGCAGAAGTGGGAGGTGGAAGG + Intergenic
1150952987 17:69823025-69823047 CTAGAGAAGGAAAAAGAGGAGGG - Intergenic
1151026821 17:70686645-70686667 CTGGAGAGGGGAAAAGAGGTGGG + Intergenic
1151343476 17:73486807-73486829 CTGGGGAAGGGGGCAGTGAAGGG + Intronic
1151423682 17:74015797-74015819 CTGGAGGTGGAGAAAGTGGAAGG + Intergenic
1152358902 17:79821045-79821067 CTGGGGAAGGGTAGATTGGAAGG - Intergenic
1152396648 17:80036929-80036951 TTGGAGTAGGGGAAAGAGGGAGG - Intronic
1152609241 17:81307491-81307513 AAGGAGAAAGGGAAAGTGAAGGG - Intergenic
1152677156 17:81647527-81647549 TTGGAGCAGGGGAGGGTGGATGG - Intronic
1152957368 18:50454-50476 CTGGAGAAGGAGAAAATTGCTGG + Intronic
1153544013 18:6186999-6187021 ATGGAGACGGGGCAGGTGGAGGG + Intronic
1153761363 18:8335239-8335261 CTGAAGGAGGGGAGAGGGGAGGG - Intronic
1154423433 18:14253663-14253685 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1155221629 18:23690230-23690252 CTGGTGGAGGGGAAAGTGTGAGG + Intronic
1155293634 18:24365654-24365676 CTGGGGCATGGGAAAGGGGAAGG + Intronic
1155670058 18:28359155-28359177 TCAGAGAATGGGAAAGTGGATGG - Intergenic
1155691651 18:28632156-28632178 CTTGAGAAAGTGAGAGTGGATGG + Intergenic
1156242732 18:35268994-35269016 CTGAATAGGAGGAAAGTGGAGGG + Intronic
1156504346 18:37579603-37579625 CTGGGGAAGAGCAAAGAGGAAGG + Intergenic
1157084995 18:44570992-44571014 GTGGAGGAGGGGAGAGAGGAAGG + Intergenic
1157127887 18:44974433-44974455 CTGCAGAAAGGCAAAGAGGAGGG + Intronic
1157278439 18:46329323-46329345 CTGGAAAAGGTGGAAGTGGAGGG - Intronic
1157422691 18:47559604-47559626 CAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1157436543 18:47674897-47674919 TTGATGGAGGGGAAAGTGGAAGG + Intergenic
1157576778 18:48748978-48749000 GGGGAGAAGGGGCCAGTGGAGGG - Intronic
1158012630 18:52746944-52746966 GTGGAGAAGGAGGAAGTGTAAGG + Intronic
1158051680 18:53228729-53228751 TTGGAGAAAGGAAAAGTTGAGGG + Intronic
1158114571 18:53980309-53980331 ATGTAGAAGGTGTAAGTGGATGG - Intergenic
1158125513 18:54095860-54095882 GAGGAGAAGGGGAAAGGAGAGGG + Intergenic
1158729181 18:60003803-60003825 CTGGAGACAGGGAAGCTGGACGG - Intergenic
1158736695 18:60090679-60090701 TTGGAGAAGGGGGATGTGGTTGG + Intergenic
1158859699 18:61580434-61580456 CAGGGGAAGGGGAAAGGAGAAGG - Intergenic
1159420330 18:68210605-68210627 GAGGTGAAGGGGAAAGTGGCAGG + Intergenic
1159756059 18:72367594-72367616 AGAGAGAAGGAGAAAGTGGAAGG + Intergenic
1159933083 18:74334305-74334327 AAGCAGAAGGGGAAAGAGGAAGG + Intronic
1160879547 19:1313236-1313258 CTGGACAAAGGCACAGTGGAGGG - Intergenic
1161918737 19:7250346-7250368 AGGGAGAAAGGGAAAGAGGAAGG + Intronic
1161988360 19:7669964-7669986 CTGGACACGGGGAACGTGGCGGG - Intronic
1162499338 19:11042581-11042603 CTGTTGGAGGGGAAAGTGAAGGG + Intronic
1162765021 19:12913972-12913994 CTGGAGAAGGAGTGAGAGGAGGG - Intronic
1162861301 19:13507316-13507338 CTAGAGAAGGAGGAGGTGGAGGG - Intronic
1162982490 19:14248614-14248636 CTGGGGAGGGGGAGAGGGGATGG - Intergenic
1163137647 19:15324202-15324224 CTGGGGAGGGGGGAAGGGGAAGG + Intronic
1163398165 19:17076047-17076069 ACGGTGAAGGAGAAAGTGGATGG + Intronic
1163549412 19:17957235-17957257 GTGGGGAAGGGGAAAGGGAAAGG + Intronic
1163728816 19:18938324-18938346 CGGGTGAGGGGGAGAGTGGAGGG - Intronic
1163884648 19:19955107-19955129 AAGGAGAAGGGGAAAGAAGAAGG + Intergenic
1164217131 19:23160656-23160678 ATGGAGAAGGGGGAAGTGTGGGG - Intergenic
1164500073 19:28811821-28811843 CTGGACTAAGGGGAAGTGGAAGG - Intergenic
1165265882 19:34663759-34663781 AGGGAGAAAGGGAAAGTGAAGGG + Intronic
1165281983 19:34805570-34805592 CTGGAAATGGAGAAAGTGGCTGG - Intergenic
1165707459 19:37986721-37986743 CAGGAAGAGGGGAAAGGGGAAGG - Intronic
1165913541 19:39244331-39244353 ATGGAGAAGGAGAAGGTGAAGGG + Intronic
1165953975 19:39490154-39490176 GTGGAGAAGGGAAGAGAGGATGG + Exonic
1166279370 19:41780774-41780796 CTGGTGATGGGGGAGGTGGAAGG + Intergenic
1166317011 19:41994674-41994696 CTGCAGGAGGGGAAGTTGGAAGG + Intronic
1166652136 19:44582660-44582682 AAGGAGAAGGGGAAAGGGAAGGG + Intergenic
1166932171 19:46308141-46308163 TTGGAGCAGGGGAATGAGGATGG + Intronic
1167201362 19:48067717-48067739 CTGGAGTAGGGGAAGGGGGTGGG - Intronic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167507513 19:49878580-49878602 GTGGAGAAGGGCAAAGCGGGTGG - Intronic
1167577349 19:50324155-50324177 CTGGGGAAGGGGGCACTGGAAGG - Intronic
1167640285 19:50678003-50678025 GTAGAGAAGTGGCAAGTGGAAGG + Intronic
1168333339 19:55582195-55582217 CTGTAGAAGAGAAAAATGGAAGG + Intergenic
1168522145 19:57060902-57060924 CTGGAGCAGGGGAGGGTGGTGGG - Intergenic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
1202639166 1_KI270706v1_random:67461-67483 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
925299438 2:2800161-2800183 ATGGAGGAAGGGAAAGAGGAAGG + Intergenic
925523792 2:4777296-4777318 CTAGAAAAGGGAAAAATGGAAGG - Intergenic
925554158 2:5110895-5110917 CTGAAGTAGGGGAGAGAGGAGGG + Intergenic
926772673 2:16392368-16392390 ATGGACAAGGGGAAAGCAGAGGG + Intergenic
926862229 2:17321509-17321531 CTGGGGATGGGAAAAGGGGATGG - Intergenic
927086564 2:19678514-19678536 CTGGAGTGGGGGAACATGGAGGG - Intergenic
927091957 2:19719151-19719173 CTGGAGAGGGGGAACCAGGAAGG - Intergenic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
927693053 2:25221927-25221949 CTAGAGAAGAGGAAAGGGAAAGG + Intergenic
927855824 2:26527471-26527493 CTGGAGAGGCGAAAGGTGGAGGG - Intronic
927993548 2:27465582-27465604 CTGGTGATGGGGCAAGGGGAGGG + Intronic
928428573 2:31199501-31199523 CTGGAGAATGGGCTGGTGGAAGG - Exonic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929248960 2:39732010-39732032 CTCGGGAAGAGGAATGTGGATGG - Intergenic
929350320 2:40943063-40943085 ATGGATAAGAAGAAAGTGGAAGG + Intergenic
929575208 2:43047346-43047368 CTGGAGACCCGGAAAGTGGGAGG - Intergenic
929897034 2:45969580-45969602 GTGGAGAAGGGGAGAGAAGAGGG - Intronic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
932088125 2:68780592-68780614 GGGGAGAAGGGGGAAGGGGAAGG - Intronic
932566464 2:72914346-72914368 CTGGACAGGGGCAAAGTGAAAGG + Intergenic
932757447 2:74418153-74418175 CTGGAGAAGGAGGAAGAGAAGGG - Intronic
932807109 2:74793978-74794000 GTGGAGTAGGGGGAAGGGGAAGG - Intergenic
932921648 2:75921541-75921563 CTGGGGAAGGGAAAAGGGGAGGG + Intergenic
933197860 2:79412780-79412802 ATTGAGAAGGAGAAACTGGATGG + Intronic
933473131 2:82753017-82753039 ATGGAGAAGAGGGAAGTGGAGGG + Intergenic
933665248 2:84959577-84959599 CTGAAGAAGGAGACAGTGTATGG - Intergenic
933843198 2:86304335-86304357 CTGGATAAGGGGAAAGACTACGG + Intronic
934777782 2:96950036-96950058 ATGGAGACGGGGAAAGAGGCAGG + Intronic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
935564219 2:104589620-104589642 CTGGGGAAGAGGTATGTGGATGG - Intergenic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
936559606 2:113525738-113525760 CTGGACATGGGGAAAGTTGCTGG + Intergenic
936820085 2:116510127-116510149 ATGGAAAGGGGGAAAGAGGAAGG - Intergenic
936838619 2:116740889-116740911 CTGGCAAAGGAGAAAGGGGAAGG + Intergenic
937080766 2:119137964-119137986 CTGGAGGAGGGGAAGTTTGAAGG + Intergenic
937552133 2:123107551-123107573 ATGGGGGAGGGAAAAGTGGAAGG - Intergenic
937800460 2:126075754-126075776 TTGGAGAAGAGGTATGTGGATGG + Intergenic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
937985027 2:127634573-127634595 CTGGGGAAGGGGAAGGTACAGGG - Intronic
938580428 2:132641064-132641086 CTGGAGGTGGGGAAAATGGCTGG - Intronic
938823072 2:134978052-134978074 CTGGAGAAGGGAAGGGAGGAAGG - Intronic
939069241 2:137518949-137518971 CTGGAAAAGGGGAAAGGGGCTGG + Intronic
939691686 2:145269830-145269852 CTGGAGAAAAGGAAAGGGGTTGG - Intergenic
940306494 2:152232691-152232713 GTGGAGATGGGGAAAGTGGATGG - Intergenic
940442062 2:153727886-153727908 GTGGGTAAGGGGAAAGTGGAGGG - Intergenic
941023098 2:160430946-160430968 CTGGAGGAGGGAAAGGGGGATGG - Intronic
941038226 2:160590594-160590616 GAGGAGAAGGGGAAGGGGGAGGG - Intergenic
941110798 2:161417233-161417255 TTGGAAAGGGGGAAAGTGGAAGG + Intronic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
941616494 2:167726367-167726389 CTGGACAAGGGGCAGGTGGGCGG - Intergenic
941699723 2:168591840-168591862 TTAGAGAAGGGGACTGTGGAGGG + Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942069024 2:172298652-172298674 GTGGAGAATGGGAGAGAGGAAGG + Intergenic
943388394 2:187230628-187230650 CTAGATAAGAGGAAAGAGGAAGG + Intergenic
943433666 2:187835361-187835383 CTGGAGAAGGGGAATGGGAGTGG - Intergenic
943553941 2:189377715-189377737 GTGAAGGAGGAGAAAGTGGAGGG - Intergenic
943696531 2:190941717-190941739 TTTGAGAAGGGGAAAGAAGAAGG + Intronic
943772313 2:191731919-191731941 CAGGAGAGTGGGAAAGTGAATGG + Intergenic
944119257 2:196223449-196223471 GAGGAGAAGGGGAAAGAGAAAGG + Intronic
944412364 2:199457462-199457484 CTGGGGAAGAGGGAAGGGGAAGG - Exonic
944415465 2:199475418-199475440 CTGGAGTAGGGGGAAGGGTATGG + Intergenic
944687140 2:202127543-202127565 ATGGAGAAGGGGACACTAGAAGG + Intronic
944943929 2:204661193-204661215 TTTGAGATGGGGAAAGAGGAAGG - Intronic
945107221 2:206327530-206327552 CTGGAGTAGGGGCAAGTGGGTGG - Intergenic
946021916 2:216646213-216646235 ATGGAGAAGAGGACAGTGGAAGG + Intronic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946301580 2:218827519-218827541 CTGGGGAAGGGGACTGTGGGAGG + Intronic
946390696 2:219415082-219415104 TGGGAGGAGGGGAAGGTGGAGGG + Intergenic
946531797 2:220578320-220578342 CTTGAGAAAGGGAAAGGAGATGG + Intergenic
946919691 2:224566065-224566087 CTGTAGATGGGGAAGGTGGGGGG - Intronic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947224057 2:227823041-227823063 ATGGAGAAGTGGAAGATGGAAGG + Intergenic
947544794 2:231003061-231003083 CTGGACAAGAGGAAATGGGAGGG + Intronic
948021348 2:234736312-234736334 CTGGAGTAGGGGAAGGGGGCAGG - Intergenic
948104456 2:235401888-235401910 CTGGAGAAGGAGAAAGTTGTAGG - Intergenic
948182827 2:235996280-235996302 CTGGAGAGGTGGGCAGTGGACGG - Intronic
948271741 2:236678910-236678932 CTGGAGCAGGGGTAAGGGGCAGG + Intergenic
948344339 2:237282679-237282701 AAGGAGAAGGGGAAGGGGGAGGG + Intergenic
948391890 2:237617687-237617709 ATGGAGAAGGGGCAAATAGATGG + Intergenic
948644447 2:239395061-239395083 CTGGAGAAGAGGAAGGTAAAGGG + Intronic
1169213433 20:3779891-3779913 GTGGAGATGCGGAAAGGGGAAGG + Intronic
1169235385 20:3926051-3926073 ATGGAGAGGGGAGAAGTGGATGG + Intronic
1169596376 20:7204266-7204288 CTGGGGAAGGGAGAAGTGGAAGG - Intergenic
1169849678 20:10035378-10035400 CTGGAGAAGAGAGGAGTGGAGGG - Intronic
1170639921 20:18142739-18142761 CTGGAGGAAGGTGAAGTGGAGGG + Exonic
1171054571 20:21893854-21893876 GTGGGGGAGAGGAAAGTGGAAGG - Intergenic
1171077036 20:22137838-22137860 GTGCAGAAGGGAAATGTGGATGG - Intergenic
1171217607 20:23363158-23363180 CTGGAGAAGGGGAGAGGGGTGGG + Intronic
1171452411 20:25245518-25245540 CTGGGGGAGGGGTCAGTGGATGG + Intergenic
1171775454 20:29363223-29363245 CTGGAGAAGGAGAAAATTGCTGG + Intergenic
1171885758 20:30651576-30651598 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1172144163 20:32744433-32744455 CTGGAGCAGGGAAATGTGGGGGG + Intergenic
1172435443 20:34925935-34925957 CTAGAGTAGGGGAACTTGGATGG + Intronic
1172474684 20:35227375-35227397 CTGGAGAAGGGGGAGGGGGAGGG + Intronic
1172801453 20:37579259-37579281 CTGGAGTAGGGGGCAGTGGCGGG - Intergenic
1172870480 20:38132501-38132523 CTGCAGAAGGGGAGAAAGGAGGG + Intronic
1173357098 20:42303773-42303795 CTGGAGATGAGAAAAGTGCATGG + Intronic
1173550641 20:43930984-43931006 CTAGTGAAGGGGATAGAGGAGGG - Intronic
1173748670 20:45458472-45458494 CTGTAGCATGGGAAAATGGAGGG - Intergenic
1174169363 20:48606597-48606619 CTGCAGAAAGCGACAGTGGACGG + Intergenic
1174339852 20:49888896-49888918 CTGGGAGAGGGGAAAGAGGATGG - Exonic
1174360045 20:50023300-50023322 CTGGGGCAGGGGAAAGTGTCAGG - Intergenic
1174476625 20:50800377-50800399 CAGGAGATGGGGCAAGTGAAGGG + Intronic
1174514695 20:51082852-51082874 GTCGGGAAGGGGAGAGTGGAGGG + Intergenic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174932874 20:54834451-54834473 CTGGAGAAGGGGAAAGGAGGAGG + Intergenic
1175121903 20:56722284-56722306 CTGCAGGAGGGAAAAGAGGAAGG + Intergenic
1175128420 20:56769959-56769981 CTGGAGAAGGCAAAACTGTAGGG - Intergenic
1175128999 20:56775118-56775140 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1175502580 20:59460887-59460909 CAGGAGATGGTGAAAATGGAGGG - Intergenic
1175616641 20:60405365-60405387 ATGGAGAAGGGGGAAGGAGAAGG + Intergenic
1175763345 20:61576034-61576056 AAGGAGAAGGGACAAGTGGAGGG + Intronic
1175780199 20:61677188-61677210 CTGGAGTAGGGGAAGGAGCAGGG + Intronic
1175998635 20:62822224-62822246 CTGGGGAGGGGGAATGGGGAGGG - Intronic
1176190888 20:63809113-63809135 CCTGCGAAGGGGAACGTGGAAGG - Intronic
1176198892 20:63850991-63851013 CTGAAGTAGGGGGAAGTGGAGGG - Intergenic
1176255111 20:64147658-64147680 CTGGGGAAGGAGATAGTGGGTGG + Intergenic
1176411816 21:6453326-6453348 GTGGTGACAGGGAAAGTGGAAGG - Intergenic
1176647489 21:9365070-9365092 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1176850036 21:13906346-13906368 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1176998817 21:15587104-15587126 GAGGAGAAGGGGCAAGGGGAAGG - Intergenic
1177258731 21:18700665-18700687 CTGGAGCAGGAGGAAGTGCAGGG - Intergenic
1177317991 21:19485420-19485442 CTTGCTAAGGGGAAAGGGGAAGG - Intergenic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1178013369 21:28313453-28313475 CTGGGGCTAGGGAAAGTGGAAGG - Intergenic
1178906700 21:36642614-36642636 CAGGGGAAGGGGAAAGAGTATGG + Intergenic
1179687310 21:43061648-43061670 GTGGTGACAGGGAAAGTGGAAGG - Intronic
1179791636 21:43759320-43759342 CTGGAGCCAGGGAAGGTGGACGG - Exonic
1179959687 21:44761060-44761082 CTGGAGAAGGGGAGAGTCCAGGG + Intergenic
1180138475 21:45876430-45876452 CTGGAGCAGGGGAAGGTGAGCGG + Intronic
1180334242 22:11561056-11561078 CTGGAGAAGGAGAAAATCGCTGG - Intergenic
1180362784 22:11914403-11914425 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1180956688 22:19744430-19744452 CTGGTGGAGGGGAAGGTGAAGGG - Intergenic
1181608789 22:23998996-23999018 CTGGAGAAGTGGGAAGTGCCTGG - Intergenic
1181652875 22:24270692-24270714 CCGGAGATGGGGGAAGGGGAGGG + Intergenic
1182017863 22:27055942-27055964 CTGGAGAAGAGTAGAGTGGCAGG + Intergenic
1182551997 22:31105622-31105644 CTGGGGGAGGGGAAATGGGATGG - Intronic
1182572587 22:31249825-31249847 CTGGACAGGGGGAAGGGGGAAGG + Intronic
1183024286 22:35052426-35052448 CTGGGGATGGGGATGGTGGATGG - Intergenic
1183253188 22:36744474-36744496 CTGGAGTGGGGGAAAGTGGTAGG + Intergenic
1183437330 22:37803622-37803644 CTGGGGAGGGGTAAAGGGGAGGG - Intergenic
1184119542 22:42441103-42441125 CTGGAGAAGGGGAGGCTGGGTGG - Intergenic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184307657 22:43617521-43617543 ATGAGGAAGGGGAAAATGGATGG - Intronic
1184561858 22:45268396-45268418 CTGGAGGAGGGGACAGAGGGAGG - Intergenic
1184648953 22:45910919-45910941 CTGGAGCAGGGGACAGAAGAGGG - Intergenic
1184987376 22:48144905-48144927 CTGGAGATGTGGCAAGTGGCTGG + Intergenic
1185091590 22:48778635-48778657 CAGGAGGAGAGGGAAGTGGAGGG + Intronic
1185119668 22:48958502-48958524 CTGGACAATGGGACAGTGGGAGG - Intergenic
949698811 3:6731635-6731657 CAGGTGAAGGGAAAAGTGCATGG + Intergenic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950119383 3:10471498-10471520 CGGGAGGAGGGGAAAGAGAAAGG + Intronic
950293467 3:11807045-11807067 CCTGAGAAGGGGAACATGGAAGG - Intronic
950430436 3:12947820-12947842 CTGGAGAAGGGGGAAGAGCTTGG - Intronic
950485629 3:13272459-13272481 CTGGTGAAAGGGAAAGTTGGTGG + Intergenic
950698955 3:14726878-14726900 CTGGAGAGGGGCAAAGGGGAGGG - Intronic
950906496 3:16543788-16543810 CTGGAGTAAGGCAAACTGGATGG - Intergenic
951170450 3:19535771-19535793 TTGGAGAGGGGGAAAGTAGAAGG - Intergenic
952509127 3:34036397-34036419 TTGGAGGAGGGGAAAGGGAAGGG + Intergenic
952759516 3:36901714-36901736 GTGGGGAAGGGGAGAGAGGATGG + Intronic
952762062 3:36923674-36923696 CTGGAGAAAGGGAAAGAGAGAGG - Intronic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
953010747 3:39023163-39023185 CTGGAAAGGGGGAAACTGGATGG + Intergenic
953119576 3:40026809-40026831 TTCAAGAAGGGGAGAGTGGATGG - Intronic
953156543 3:40380323-40380345 CTAGAGCAGGTGCAAGTGGATGG + Intergenic
953242215 3:41159742-41159764 TTGGAGAAAGTGAGAGTGGAAGG - Intergenic
953390777 3:42532484-42532506 CTGGAGCAGGGGATGGTGGTGGG - Intronic
953757671 3:45661145-45661167 ATGGAGTAGGGGAATGTGGGTGG - Intronic
953829528 3:46283645-46283667 CTTGAGAATGGGTAAATGGAAGG - Intergenic
954246920 3:49339653-49339675 GTGGAGAAGGGGAAGGTTGGTGG - Intronic
954511395 3:51129034-51129056 CTGGGGAAGAGGTATGTGGATGG - Intronic
954529261 3:51304231-51304253 CTGGTGCTGGGGAAACTGGACGG - Intronic
955002199 3:54937869-54937891 CTGGAGAAGGGGTGAGAGGCTGG + Intronic
955104866 3:55888321-55888343 CTTGAGAGTGGGAAAGGGGAAGG - Intronic
956004256 3:64762054-64762076 GTGGAGGAGGGGAAAATGGGAGG - Intergenic
956051420 3:65252254-65252276 CTGCAGATGGGGAAAGAGCAAGG - Intergenic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956553012 3:70482958-70482980 CTGGAGAATGAGAAAGGGGCTGG + Intergenic
956939918 3:74146651-74146673 ATGGAGAAGGGGACAGAGAAGGG - Intergenic
957219814 3:77367375-77367397 GTTGGGAAGGGGAGAGTGGAAGG - Intronic
957265955 3:77966111-77966133 CTGGAGTAGGGGGAAGGGGAAGG + Intergenic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
958023953 3:88028435-88028457 ATGGAGAACTGGAAAGGGGATGG - Intergenic
958204230 3:90369521-90369543 CTGGGGTGGGGGAAAGTGGGAGG - Intergenic
958506397 3:94984249-94984271 GTGGAGTGGGGGAAAGGGGAAGG - Intergenic
958951077 3:100416874-100416896 CTGGGTTAGGGGAAAGGGGAGGG - Intronic
959171709 3:102852147-102852169 CTGGAGCAGGAGAAAGGGAATGG - Intergenic
960727683 3:120686982-120687004 GGGGAGAAGGGGTAAGGGGAAGG + Exonic
961155701 3:124677838-124677860 CTTGAGAAGGGCACGGTGGATGG - Intronic
961200115 3:125038806-125038828 CTGGAGAAATGGAAAGGAGACGG + Intronic
961599204 3:128046096-128046118 CTTGAGAAGGAGAAAGGGGAGGG - Intergenic
961660270 3:128464936-128464958 AGGGAGAAGGGGGAAGGGGAGGG - Intronic
961728539 3:128950090-128950112 CTGGAATAGGGGATAGTTGAGGG + Intronic
962254507 3:133861113-133861135 CTGCAGAAGGGGAAGGGGGCTGG + Intronic
963229173 3:142892444-142892466 GTGGGGCAGGGGAAAGAGGAAGG - Intergenic
963582714 3:147147170-147147192 CTGGGGAAGGGGTGAGTGAAGGG + Intergenic
963837413 3:150071054-150071076 CTGGACAAGGGGAGAGTGGCAGG + Intergenic
964420979 3:156502232-156502254 CTGAAAATGGGTAAAGTGGAAGG + Intronic
964833332 3:160910251-160910273 AAGGGGAAGGGGAAAGGGGAAGG - Intronic
964846473 3:161049616-161049638 CTGTAGAATGGGATAGGGGATGG + Intronic
964990307 3:162802601-162802623 ATAGAGAAGAGGCAAGTGGATGG + Intergenic
965480318 3:169210757-169210779 GTGGAAAAGGGGAAACTGAAAGG - Intronic
965698663 3:171437315-171437337 CTGGAACAGAGCAAAGTGGAAGG - Intronic
966241636 3:177760796-177760818 TTGGAGAAGGAAAAAGTGGTTGG + Intergenic
966596331 3:181727260-181727282 CTGGAGGCGGGGAAAGGGGGGGG - Intergenic
966889649 3:184397794-184397816 CTGGAAAAGGGGAAGAAGGAAGG + Intronic
966897655 3:184457729-184457751 AAGGGGAAGGGGAAATTGGAGGG + Intronic
967133045 3:186490202-186490224 CTGGAGAATGGGATGGTGGAAGG + Intergenic
967739447 3:192988996-192989018 CTGGAGAAGGAAAAAGGGCATGG - Intergenic
967913452 3:194560434-194560456 CTGGAGAATGGGCAGGTGGGTGG - Intergenic
967983070 3:195077200-195077222 CTGGGGAAGGGAAAAGCAGAGGG + Intronic
968229319 3:196996055-196996077 CTGGGGAAGAGGAAAGAGCAGGG - Intronic
968241214 3:197087958-197087980 GTGGAGAAGGGGAAGGTGGTTGG + Intronic
1202739390 3_GL000221v1_random:39917-39939 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
968378991 4:72709-72731 CAGGAGAAATGGAAATTGGAAGG - Intronic
968519153 4:1027935-1027957 CTGGAGTAGGGGAGGGTGGAAGG + Intergenic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
969057932 4:4413711-4413733 CTGGAGGAGGGGGAAGTGATAGG + Intronic
970354239 4:15236407-15236429 CGTGAGAAGGGGAAAGGGGCTGG + Intergenic
971162190 4:24144695-24144717 ATAGAAAAGGGGAAAGTGGAGGG - Intergenic
971466404 4:26967799-26967821 AGGGGGAAGAGGAAAGTGGAGGG - Intronic
971520360 4:27541852-27541874 CTGGACAAGGGGCAAGAGCATGG + Intergenic
971636645 4:29068717-29068739 AGGGAGAAGGGGAAAGGGGAGGG - Intergenic
971858369 4:32072193-32072215 CTGGAGAACAGGTAAGTGAAGGG - Intergenic
972109552 4:35541135-35541157 CTGGGGAAGGGGTGAGTGAAGGG + Intergenic
972346453 4:38196515-38196537 CAGGAGAAGGGGGAGTTGGAGGG + Intergenic
972507068 4:39729620-39729642 CTGGAGTAGGGGGAAATGGCTGG - Intronic
972734336 4:41826186-41826208 CTGGAGGAGGAGCAAGTGGGTGG - Intergenic
972770534 4:42193209-42193231 CAGGAGAGGAGGAAAGTGGAAGG - Intergenic
972790264 4:42364981-42365003 GGGGAGAAGAGGGAAGTGGAGGG - Intergenic
972830034 4:42803791-42803813 CTGGAGCAGGAGAAAGTGGGGGG + Intergenic
972935665 4:44131846-44131868 CTGGAGGAAGGGAGAGTGGAGGG + Intergenic
973001749 4:44960910-44960932 AGGGAGATGGGGAAAGGGGAAGG - Intergenic
973369403 4:49233821-49233843 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
974855144 4:67452426-67452448 CAGGAGAAAGAGAAAGTGAAGGG - Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
977065144 4:92304804-92304826 CCGGAGAGGGGGAAAGCGAAGGG - Intronic
977116026 4:93030236-93030258 CGGGAGAAAAGGAAAGAGGAAGG - Intronic
977686945 4:99857587-99857609 CTGGAAAAGGGCAACGTGCAAGG - Intronic
978685362 4:111435840-111435862 TTGGAGAAGAGGAATGTGGCTGG - Intergenic
979238960 4:118431675-118431697 CTGGAGAAAAGGACAGTGAATGG - Intergenic
979307008 4:119158034-119158056 ATGCAGAATGGGAAAGTGGATGG + Exonic
980822578 4:138036652-138036674 CTGGAGAAGGACAAAGAGGTTGG - Intergenic
980882329 4:138724558-138724580 ATAGAGAAGGGGAAAGAGGCAGG - Intergenic
981005944 4:139875314-139875336 CAGGAGAAGGTGGAAGTGGTGGG + Intronic
981117608 4:141010448-141010470 CTGGAGGACTGCAAAGTGGATGG - Intronic
981220231 4:142223436-142223458 ATGGAGGAGGGAAAAGTGTATGG - Intronic
981426661 4:144611332-144611354 CTGGAGCAGGAGGAAGTGGGGGG - Intergenic
981430235 4:144648759-144648781 GAGGAGAAGGGGAAGGGGGATGG + Intronic
981495758 4:145390544-145390566 ATGGAGAAGGGGAGAGAGGGAGG + Intergenic
984190218 4:176596614-176596636 CTGGAGAGAGGGATAGGGGAAGG - Intergenic
984208006 4:176809907-176809929 CTGGAAAGGAGGAAAGTGGATGG - Intergenic
984591536 4:181622799-181622821 CCAGAGAAAGGGAATGTGGAAGG - Intergenic
984911437 4:184676929-184676951 AGGGAGAAGGGGAAGGGGGAAGG - Intronic
1202766516 4_GL000008v2_random:153331-153353 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
985552725 5:541619-541641 GAGGAGCAGGGGAAGGTGGAGGG - Intergenic
985913450 5:2900533-2900555 CTGGGGAGGGAGAAAGTGGAGGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
985913510 5:2900766-2900788 CTGGAGAGGATGAAGGTGGAGGG - Intergenic
986552900 5:8978627-8978649 CTGGAGGAGGAGAAAGAGGTGGG - Intergenic
986627122 5:9732494-9732516 ATGGACAAGGGGAAGATGGAAGG + Intergenic
987153264 5:15062295-15062317 CTGGGGAAGAGGTATGTGGATGG + Intergenic
987268280 5:16278685-16278707 ATGGGGAATGGGAAAGGGGATGG - Intergenic
987466172 5:18274900-18274922 TTGGAGAAGAGGTATGTGGATGG - Intergenic
987510838 5:18836312-18836334 GAGGAGGAGGAGAAAGTGGAGGG - Intergenic
987842946 5:23244519-23244541 CAGGAGGAAGGGAAAGTGAAGGG + Intergenic
988006492 5:25418476-25418498 CTGGAGCAGGAGGAAGGGGAGGG + Intergenic
988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG + Intronic
988715982 5:33828830-33828852 GTGGAGAAGGGGTAAAGGGAGGG + Intronic
988883350 5:35529495-35529517 AATGAGAAGGGAAAAGTGGAAGG - Intergenic
988894456 5:35657030-35657052 CTGGAGGAGAGGAGAATGGATGG - Intronic
989238896 5:39180760-39180782 CTGGAGAAGTAGAAAGTAGATGG - Intronic
989664076 5:43832519-43832541 CTGGAGGAAGGGAAAGGGTAAGG - Intergenic
990031117 5:51260998-51261020 CTGGTGAAAGGGAAAATGGGGGG - Intergenic
990186703 5:53217963-53217985 GAGGAGAAGGGGGAAGAGGAGGG + Intergenic
990197822 5:53338215-53338237 CTGGGGAAGAGGCAAGTAGATGG + Intergenic
990428858 5:55714775-55714797 CTGGAGAAGGAGATAGTTGGGGG + Intronic
990649788 5:57885354-57885376 TTGAATATGGGGAAAGTGGAAGG + Intergenic
990662308 5:58029771-58029793 CTGGAGATGGGGAAGCTGTATGG + Intergenic
991402925 5:66273126-66273148 CTGCTGAAGGGGAAGCTGGAAGG - Intergenic
991601054 5:68351508-68351530 CAGGATAAGGGGAAAGGAGAAGG - Intergenic
992004627 5:72465363-72465385 CTGGGGAAGGGGAGTGTTGAAGG + Intronic
992298931 5:75357493-75357515 TTGGGGAAGGGGAAAATGGGTGG + Intronic
993070416 5:83155070-83155092 CTGGGGCAGGAGAAAGAGGAAGG + Intronic
993361508 5:86982168-86982190 CAGCAAAAGGGGAAAGAGGAAGG - Intergenic
993367384 5:87050333-87050355 TTGGGGAAGAGGTAAGTGGATGG - Intergenic
993373362 5:87119168-87119190 AGGGAGAAGAGGAAAGCGGAGGG + Intergenic
995029775 5:107466845-107466867 CTGGAGCTGGGGCAAATGGAAGG + Intronic
995504071 5:112840606-112840628 CTGGAGAAGGAGTTAGAGGAGGG + Exonic
995655716 5:114423909-114423931 ATGGAGAAAGGGAAGGTGCAGGG + Intronic
996016005 5:118534660-118534682 CTGGGGAAACGGGAAGTGGAGGG - Intergenic
996392117 5:122973161-122973183 CTGGGGAAGAGGTATGTGGATGG - Intronic
996464478 5:123783416-123783438 CTTGGGAAGGTGAAAGGGGAGGG + Intergenic
996629701 5:125612682-125612704 CTAGAGAACAGGAAAGAGGAAGG + Intergenic
996695775 5:126393175-126393197 ATGGAAAAGGGGAAAGTGAAGGG - Intronic
997428800 5:133823395-133823417 CTGGAGAGGAGGAGAGTGCAGGG - Intergenic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
999389717 5:151181161-151181183 CTGGAGAAGGAGCAAGTTGTGGG - Exonic
999413319 5:151371890-151371912 CGGGAGACAGGGAAAGGGGAGGG + Intergenic
999657956 5:153828966-153828988 CAGGAGGAGGGGCAAGTGCAAGG - Intergenic
1000125270 5:158237606-158237628 CTGGAGAAGTGGGGTGTGGAGGG + Intergenic
1000187074 5:158869491-158869513 TTGGAGAAGAGGAAATAGGAGGG - Intronic
1001104712 5:168843282-168843304 CAGGTGAAGAGGAAGGTGGAGGG + Intronic
1001276522 5:170355321-170355343 CTGGAGAAGGAGAAAGCAAAGGG + Intronic
1001288402 5:170439727-170439749 CTGGGGAAGGGGAATGTTGCTGG - Intronic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001681267 5:173558792-173558814 CTGGAGATGGGAAAATGGGAGGG - Intergenic
1002061471 5:176628333-176628355 CGGGAGAAGGCTAAAGTGCATGG - Intronic
1002260007 5:177986459-177986481 CTGGATAAGAGGAAACTGTAGGG + Intergenic
1002461419 5:179375818-179375840 CAGGAGAGGGGGAAAGGGGGAGG + Intergenic
1002461526 5:179376080-179376102 CTGGGGGAGGGGAAAGGGGGAGG + Intergenic
1002663251 5:180804830-180804852 CAGGTGAAGGGGAAACAGGATGG + Intronic
1003158031 6:3612787-3612809 GTGGAGGAGGGGAAAGTGTCAGG + Intergenic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003403361 6:5809088-5809110 AAGGAGAAGGGGAAAAAGGAAGG - Intergenic
1003660522 6:8056499-8056521 CTGGAGAAGGTGGCAGTGGCGGG - Intronic
1003899744 6:10643341-10643363 ATGGAGAAGGGGAAGGTCAAGGG - Intergenic
1003982781 6:11405075-11405097 ATGGGGAAGGGGATAGGGGAAGG + Intergenic
1004710250 6:18162953-18162975 CTGGAGAAGGGGACCGTGGCAGG + Intronic
1005214084 6:23504632-23504654 CTGGAGAAGAAGTAAGTGTACGG - Intergenic
1005354532 6:24969705-24969727 CAAGTGAAGGGGAGAGTGGAGGG - Intronic
1005367567 6:25094636-25094658 CTGGAGTAAGGGAGAGTGGTTGG - Intergenic
1005495385 6:26383487-26383509 CTCGGGGAGGGGGAAGTGGAGGG + Intronic
1005947973 6:30608833-30608855 CTGGAGGAGGGGAATGTTGTTGG + Exonic
1006285355 6:33089080-33089102 CAGGGGATGGTGAAAGTGGAAGG + Intergenic
1006307885 6:33235587-33235609 TTAGGGAGGGGGAAAGTGGAGGG + Intergenic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1006517642 6:34553665-34553687 CTGGAGAAGAGGAAAGAGAGAGG + Intronic
1006602320 6:35234158-35234180 TTGGAGAAGGGGGAAATGAAAGG + Intronic
1006652437 6:35562814-35562836 CTGGAGAAGGAGAAAGGGAAGGG + Intergenic
1006805104 6:36783005-36783027 GTGGAGAAGGCGAAAGGAGATGG + Intronic
1006967604 6:38004451-38004473 ATGGAGAGGGGGAGAGGGGAAGG - Intronic
1007094043 6:39202462-39202484 CTGGGGAAGGGGCAAGGTGAGGG + Intronic
1007748252 6:44056484-44056506 CTGAAGAAGGAGAAAGGAGATGG + Intergenic
1008437783 6:51496458-51496480 CTGGAGAAGGGGATACTGGCAGG - Intergenic
1008849333 6:56005739-56005761 CTGGAGAAGGGCAGAATGGTTGG + Intergenic
1010107860 6:72189940-72189962 CTGGGGAAGAGGTACGTGGATGG - Intronic
1010121605 6:72382096-72382118 TTGGAAAATGGGAAAATGGAAGG + Intronic
1010431639 6:75784463-75784485 ATGGAGAAGAGCAAAGTGAAAGG + Intronic
1010474939 6:76275783-76275805 ATGGAGGAGGGGAAAGGGAAAGG - Intergenic
1010938156 6:81885792-81885814 TTGGGGAAGGGGGATGTGGATGG - Intergenic
1010941562 6:81924802-81924824 GTGGAGAAGGAGGAGGTGGAAGG + Intergenic
1011268206 6:85548160-85548182 CTGGAGATGGGGAATGGGGATGG + Intronic
1011959559 6:93070248-93070270 GTGGGGAAGGGGAAAGGGAAAGG + Intergenic
1012002038 6:93665554-93665576 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012344674 6:98170951-98170973 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012873290 6:104696523-104696545 CTGCAGAAGAGGAAAGGGGAAGG + Intergenic
1012910021 6:105107775-105107797 TTGAAGAATGGGAATGTGGAAGG + Intronic
1013007824 6:106090558-106090580 CTTTAGAAGGTGAAAGAGGATGG + Intronic
1013029596 6:106320268-106320290 ATGGGGCAGGGGAAAGAGGAGGG + Intronic
1013301420 6:108808474-108808496 CTGGAGAAGGGGGTGGTGCATGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013822354 6:114170054-114170076 ATGGAGAAGGTTAAAGTAGAAGG + Intronic
1014422866 6:121266911-121266933 GTGGGGAAGGGGCAAGGGGAGGG + Intronic
1014534102 6:122595974-122595996 TTGCAGAAGAGGTAAGTGGATGG - Intronic
1015082517 6:129245025-129245047 CTGAAGAACAGGAAAGTGAATGG + Intronic
1015095359 6:129408970-129408992 CTGGGGAAGAGGTATGTGGATGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1015389705 6:132667827-132667849 CTGAAGAAAGGGGAGGTGGAAGG - Intergenic
1015475837 6:133658113-133658135 TTGGAGAAGAGGTATGTGGATGG + Intergenic
1016291580 6:142534066-142534088 TTGGAGAAGTGGCAAGGGGAAGG - Intergenic
1016374037 6:143402318-143402340 CAGGACAACGGGAAAGTGGGGGG + Intergenic
1017041816 6:150314259-150314281 CTGCAGAAGGGGAGAGGGGAGGG + Intergenic
1017352629 6:153459643-153459665 CTGAGGAAGGGGTAAGTGAAGGG - Intergenic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017645621 6:156537384-156537406 CTGGAGAAGGTGAAATAGAATGG - Intergenic
1018144870 6:160876801-160876823 CTGAGGAAGGGGTAAGTGAAAGG + Intergenic
1018607958 6:165618453-165618475 CTGGAGAAGAGGAAGGCTGATGG - Intronic
1018824973 6:167402045-167402067 CTGGAGAAGGAGGAACCGGAGGG + Intergenic
1018946717 6:168352400-168352422 CTGGAGCAGGAGAAAGAGGTGGG + Intergenic
1018965520 6:168484937-168484959 CTGGGGAAGGGGAAATGGGGAGG + Intronic
1019293653 7:262485-262507 CTGGAGTCTGGGTAAGTGGAGGG + Intergenic
1019511033 7:1417368-1417390 CGGGAGAAGGGGCAACAGGAAGG - Intergenic
1020048015 7:5057992-5058014 CTGGAGAAAGAGGAAGTGAATGG - Intronic
1020115322 7:5473000-5473022 CTGCAGCAGGGGAGAGAGGATGG - Intronic
1020372906 7:7453853-7453875 CTGAAGAAGAGGAAAAGGGAAGG - Intronic
1021187795 7:17585649-17585671 CTGGAGAGTGGGAATGTGGTTGG + Intergenic
1021482919 7:21137354-21137376 CAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1021674603 7:23067651-23067673 CAGGGGAAGGGAAAGGTGGATGG + Intergenic
1021706001 7:23368512-23368534 CTGAGGAAAGTGAAAGTGGAGGG + Intronic
1021763261 7:23921862-23921884 GTGGATAGGGAGAAAGTGGAGGG + Intergenic
1021904856 7:25323045-25323067 CTGGGGAAGGGGATAATGGAGGG + Intergenic
1022435442 7:30379749-30379771 CTAGAGGAGGGGAAAATTGAGGG - Intronic
1022873493 7:34503998-34504020 CTGGAGCAGGAGCAAGAGGAGGG + Intergenic
1022873885 7:34507904-34507926 GTAGAGAAGGGGAAAGGGGAGGG - Intergenic
1023362478 7:39430863-39430885 CTGGGGAAGGCCAGAGTGGATGG + Intronic
1023526271 7:41107047-41107069 TTGGAGTAGGGGAAAGGGCAAGG - Intergenic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024920158 7:54546332-54546354 CGGGAGGAGGGGAGAGGGGAAGG + Intronic
1025207146 7:57000450-57000472 ATGAAGAATGGGAAAGGGGAGGG - Intergenic
1025664790 7:63576440-63576462 ATGAAGAATGGGAAAGGGGAGGG + Intergenic
1026311188 7:69186085-69186107 CTGAGGCAGGGGAAAGTGGCAGG - Intergenic
1026355486 7:69553564-69553586 CTGGAGAAGGGAAGTGGGGAAGG - Intergenic
1026638945 7:72107537-72107559 CTGGAGAAGGGGACTCTGGGTGG - Intronic
1026685145 7:72503529-72503551 TTGCAGAAGGGAAAAGTGAAAGG - Intergenic
1026800639 7:73397843-73397865 GAGGAGTAGGGGAAAGGGGAGGG + Intergenic
1026834829 7:73631738-73631760 AGGGAGAAGGGGAGAGAGGAAGG - Intergenic
1027132246 7:75599325-75599347 CTGGAGGAGGAGAAAGGGGCGGG - Intronic
1027406972 7:77872363-77872385 CTGGGGAAGAGGTATGTGGATGG - Intronic
1027564948 7:79780072-79780094 GTGGAGTAGGGGAAGGGGGAAGG - Intergenic
1027815454 7:82964081-82964103 CTGGAGAAGGGAGAAAAGGAAGG + Intronic
1028237913 7:88383452-88383474 TTGGAGAAGAGGTATGTGGATGG + Intergenic
1028242399 7:88437267-88437289 CTTGAGAAAGTGAAAGAGGATGG - Intergenic
1028516974 7:91688445-91688467 TTGGAGATGGGGCATGTGGAAGG - Intergenic
1029290415 7:99498351-99498373 CTGGAGAAGGATAGAGGGGAAGG + Intronic
1029354377 7:100040647-100040669 AAGGAGAAGGGGGAAGAGGACGG + Exonic
1029575785 7:101402426-101402448 CCAGAGAAGGGGAAAGGGGAAGG - Intronic
1029578307 7:101418845-101418867 GTGGAGAGGAGGAAAGAGGAAGG - Intronic
1029858531 7:103543919-103543941 TTGGAGGAGGGGAAAGTGAGGGG - Intronic
1030277626 7:107737264-107737286 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1030379977 7:108800765-108800787 CAGGAGGAGGGGAGAGGGGAAGG - Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031595108 7:123640723-123640745 GAGGAGAAGGGGAAGGGGGAAGG + Intergenic
1031642810 7:124186225-124186247 CTGGAGAAGGAGCCAATGGAGGG + Intergenic
1032254154 7:130283852-130283874 CTAGAGAAGGAGAAAAAGGATGG + Intronic
1032522754 7:132558866-132558888 CAAGAAAAGGGGAAAGTGTAGGG + Intronic
1032583909 7:133129173-133129195 CTGGGGAAAGGGCATGTGGATGG + Intergenic
1033033990 7:137853892-137853914 ATGGAGAAAGGGAATGTGAATGG - Intergenic
1033141580 7:138831846-138831868 CCGGAGGAGGGCAAAGTCGAGGG + Intronic
1033245052 7:139710869-139710891 CTGGAGAAGGAGAAAGAGAGAGG - Intronic
1033996234 7:147353289-147353311 GGGGAGTAGGGGAAAGGGGAGGG - Intronic
1034169895 7:149054902-149054924 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1034417017 7:150970607-150970629 CTAGAGAAGGGAAAGGTGGAGGG + Intronic
1034439870 7:151081137-151081159 CTGGTGAAGGGGAGCGGGGAGGG - Exonic
1034560328 7:151876086-151876108 CTGGAGACGGAGAGAGGGGAGGG - Intronic
1034697642 7:153068157-153068179 CTGCAGAAGAGGAAGCTGGAAGG + Intergenic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1034944920 7:155255652-155255674 AAGAAGAAGGGGAAAGGGGAAGG + Intergenic
1035232727 7:157476125-157476147 CTGGAGAATGAGAAACAGGATGG + Intergenic
1035477498 7:159153634-159153656 GAGGAGGAGGGGAAAGGGGAGGG - Intergenic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035797943 8:2376470-2376492 CTGGTGAAGGGGAAGCTGGCAGG + Intergenic
1035998574 8:4576380-4576402 CTGGGGAATGGGACAGGGGAAGG - Intronic
1036181360 8:6588194-6588216 CTGGACTAGGAGAAGGTGGAGGG - Intronic
1037053684 8:14408677-14408699 CTAGATGAGGGGAAAGTGGCAGG - Intronic
1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG + Intronic
1037739855 8:21599812-21599834 CAGGAGAAGGGGTAGGAGGAAGG + Intergenic
1037787870 8:21913066-21913088 CCAGGGAAGGGGAAAGAGGATGG + Intronic
1039253857 8:35696792-35696814 CTGGAGAATGGGGAAGGGCAGGG - Intronic
1039324087 8:36465916-36465938 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1039608891 8:38903551-38903573 CTGCAGAAGTGGGAAGGGGAAGG + Intronic
1040453686 8:47574745-47574767 CTTGAGAAGAGGAGAGGGGAGGG + Intronic
1041311109 8:56517503-56517525 GAGGAGGAGGGGAAAGAGGAGGG - Intergenic
1041419220 8:57647733-57647755 CTGGAGAAATGGAAGATGGATGG - Intergenic
1041433561 8:57811632-57811654 CTGGAGAAGGGCAAAGAGGAAGG + Intergenic
1042147075 8:65740898-65740920 ATGGAGCAGGTGAAACTGGAGGG - Intronic
1042378051 8:68078633-68078655 CTGGAGATAGGGAAACAGGATGG - Intronic
1042871712 8:73405656-73405678 TTGGGGAAGGGGAAGCTGGAAGG - Intergenic
1043050351 8:75377550-75377572 CAGTAGTAGGGGAAAATGGAAGG - Intergenic
1043127496 8:76418064-76418086 CTGGAGAAAGAGAGAGTGAAGGG - Intergenic
1043203825 8:77409975-77409997 CTGGAGAAGGGGACATTTTAAGG + Intergenic
1043284639 8:78514310-78514332 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1043796672 8:84550234-84550256 AAGGAAAAGGAGAAAGTGGAGGG - Intronic
1043800928 8:84608540-84608562 CTGGGGAAGGGCAAAGTGGGAGG - Intronic
1044434707 8:92148373-92148395 TTGGGGAAGGGGTATGTGGAGGG + Intergenic
1044492367 8:92834608-92834630 GTGGAGAAGGGACAGGTGGAGGG - Intergenic
1044619116 8:94172000-94172022 CGGGAGAAGGGGAGGGAGGAGGG - Intronic
1045178251 8:99750390-99750412 CTCAAGAAGAGCAAAGTGGAAGG - Intronic
1045714668 8:105027151-105027173 CTGGAGAAGGTAAACGTTGAGGG - Intronic
1045892927 8:107179155-107179177 CTGGAGAAGATGAAATTTGATGG + Intergenic
1047811517 8:128414905-128414927 CAGGGGAAGGAGAAAGTGAAGGG + Intergenic
1048122616 8:131598802-131598824 CTGGGGACAGGGAAAGTGGTAGG - Intergenic
1048207981 8:132430972-132430994 TGGGAGAAGGGAAAATTGGAAGG - Intronic
1048456696 8:134584788-134584810 CGGGGGAAGGGGAAAGAGGGCGG + Intronic
1048781180 8:138003677-138003699 GTGGAGCAGCAGAAAGTGGAAGG - Intergenic
1048805098 8:138232939-138232961 GTGGTGAAGAGGAAAGTGGGAGG - Intronic
1049070605 8:140352690-140352712 CTGGGGAAGGGGTGAGTGGGAGG - Intronic
1049180391 8:141219150-141219172 CTGGAGAAGGAGAAAGCAGTAGG + Intronic
1049238191 8:141523201-141523223 CTGGAGCAGGGGCAAGGAGAGGG - Intergenic
1049280792 8:141743181-141743203 CTGGAGAAGGGTGATGGGGAAGG + Intergenic
1049280819 8:141743292-141743314 CTGGAGAAGGGTGACGGGGAAGG + Intergenic
1049280842 8:141743387-141743409 CTGGAGAAGGGTAATGGGGAAGG + Intergenic
1049893262 9:90634-90656 CTGGACATGGGGAAAGTTGCTGG - Intergenic
1050482761 9:6103231-6103253 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1050690750 9:8223835-8223857 CAGGAGAAGAGGAAGGGGGAAGG + Intergenic
1050733540 9:8736906-8736928 CGGGAGGAGGGGAATGGGGAGGG - Intronic
1050945783 9:11515336-11515358 CTGGAGCAGAAGGAAGTGGAAGG - Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051524768 9:18031602-18031624 CTGGGGAAGGGGAGATGGGAGGG + Intergenic
1051697216 9:19781368-19781390 ATGAAGTAGGGGAAGGTGGAAGG + Intronic
1051785026 9:20732756-20732778 CTAGAGATGGGGGAAGTAGAGGG + Intronic
1052415007 9:28167146-28167168 CTGGAGAAAAGAAAAGTGGGGGG - Intronic
1052561478 9:30089360-30089382 CTGGGGAAGAGGTATGTGGACGG - Intergenic
1052877287 9:33576370-33576392 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1052918200 9:33939994-33940016 GAGGAGGAGGGGAAAGAGGAGGG + Intronic
1053064456 9:35057711-35057733 CTGGAAAAGGGAAAACTGTAGGG + Intronic
1053453742 9:38214719-38214741 AAGGAGAAGGGGAAAGGGGTTGG + Intergenic
1053498715 9:38568024-38568046 CTGGAGACAGGGCAAGAGGAAGG - Intronic
1053605949 9:39658657-39658679 CTGGGGAAGGGATAAGTGAAGGG - Intergenic
1053662477 9:40293281-40293303 CTGGAGACAGGGCAAGAGGAAGG + Intronic
1053734473 9:41090688-41090710 CTGGACATGGGGAAAGTTGCTGG - Intergenic
1053863867 9:42415281-42415303 CTGGGGAAGGGATAAGTGAAGGG - Intergenic
1053912931 9:42923456-42923478 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1054247596 9:62683759-62683781 CTGGGGAAGGGATAAGTGAAGGG + Intergenic
1054374606 9:64439506-64439528 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1054561712 9:66718286-66718308 CTGGGGAAGGGATAAGTGAAGGG + Intergenic
1054693912 9:68340885-68340907 CTGGACATGGGGAAAGTTGCTGG + Intronic
1054723161 9:68623788-68623810 GTGGAGAAGGGGGAAGAGGAAGG + Intergenic
1055018063 9:71640405-71640427 CCTGAGAAGGGGAGAGTGGGTGG - Intergenic
1055397257 9:75889229-75889251 CTGGAGAAAGGGGAAGGGGGAGG - Intergenic
1055808922 9:80128416-80128438 CTGGAGAACAGGAATGTGCACGG + Intergenic
1055858267 9:80718052-80718074 CAGGAGTAGGGGAAATGGGAAGG - Intergenic
1056412264 9:86341727-86341749 CAGGAGAGGGGGAAACGGGAGGG - Intronic
1056688036 9:88782861-88782883 ATGGGGAAGGGAAGAGTGGAGGG + Intergenic
1056974510 9:91239171-91239193 CTTGAGAAGGGAAAAGATGAAGG - Intronic
1057161768 9:92894322-92894344 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1057414121 9:94846225-94846247 CTGGAGAAGCACAACGTGGAAGG + Intronic
1057678166 9:97152517-97152539 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1058407355 9:104691702-104691724 TTGAAGTAGAGGAAAGTGGAAGG - Intergenic
1058580196 9:106447534-106447556 GTGGAGAAGGTGGAAGGGGAGGG - Intergenic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059520770 9:114939788-114939810 TTGGAGTAGAAGAAAGTGGAAGG - Intergenic
1059561472 9:115338830-115338852 AAGGAGAAGGGAAATGTGGAAGG - Intronic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1060797829 9:126524642-126524664 CTGGAGACAGGGACAGTGGAGGG - Intergenic
1060903837 9:127287025-127287047 GTGGAGAAGGAAAAAGTGCATGG + Intronic
1061319393 9:129818583-129818605 CTGGAGGAGTGGAAAGCAGAGGG - Exonic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1061842438 9:133367130-133367152 CTGGAGAAGAGGGGAATGGAGGG + Intronic
1061947441 9:133916576-133916598 ATGGAGAAGGGGAAAGGAGGGGG + Intronic
1062135563 9:134925636-134925658 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1062335116 9:136061517-136061539 CTGGGGTAGGGGAAGGCGGATGG + Intronic
1062740778 9:138174119-138174141 CTGGAGAAGGAGAAAATTGCTGG - Intergenic
1203491355 Un_GL000224v1:108419-108441 CTGGAGCAGGAGAAAGTGGGTGG + Intergenic
1203503979 Un_KI270741v1:50289-50311 CTGGAGCAGGAGAAAGTGGGTGG + Intergenic
1203708033 Un_KI270742v1:69866-69888 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1203547271 Un_KI270743v1:138209-138231 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1185499333 X:585095-585117 GTGGAGAAGGGGGAGGAGGAGGG + Intergenic
1185943489 X:4347809-4347831 TTGGAGACTGGGAAAGGGGATGG + Intergenic
1186459946 X:9740034-9740056 CAGGAGAAGGAGAAAGTGGGAGG + Intronic
1186639197 X:11437090-11437112 AGGGAGAAAGGGAAAGAGGAAGG + Intronic
1186844580 X:13517962-13517984 CTGGGTATGGAGAAAGTGGAAGG - Intergenic
1186925387 X:14328283-14328305 CTGGAGAGGGGAAATGTGCAAGG - Intergenic
1187253464 X:17620866-17620888 GTGGGGAGGGGAAAAGTGGAGGG + Intronic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1188095193 X:26012620-26012642 GTGGAGAAGGGAAAATTAGAGGG + Intergenic
1188132080 X:26448553-26448575 ATGAAGAGGGGGTAAGTGGATGG - Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188567593 X:31544425-31544447 GGGGAGAAGGGGGAAGGGGAAGG - Intronic
1189230769 X:39450895-39450917 ATGGAGGAGGGGAGAGTGGAGGG - Intergenic
1189534599 X:41923507-41923529 CGGGAGGAGGAGAAAGAGGAGGG - Intergenic
1189575694 X:42350778-42350800 GTGGAGAAAAGCAAAGTGGAGGG + Intergenic
1189668978 X:43387642-43387664 CAGGAGCAAGAGAAAGTGGAAGG - Intergenic
1190311800 X:49122272-49122294 CAGGAGAAGGGGCAGGTGGCGGG + Intronic
1190511037 X:51174714-51174736 CTGAAGAGGGGGAAATGGGAAGG + Intergenic
1190799076 X:53771822-53771844 CTTAAGAAGGAAAAAGTGGAAGG + Intergenic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1190996666 X:55616856-55616878 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1192053211 X:67746106-67746128 AGGGAGAAAGGGAGAGTGGAGGG - Intergenic
1192269646 X:69566673-69566695 CTGGAGAAGGGGCAGGTGTAGGG + Intergenic
1192434620 X:71135508-71135530 GTGGAGCAGAGGAAAGAGGAGGG - Intronic
1192437571 X:71152406-71152428 CTGGGGTGGGGGAAAGGGGAAGG - Intronic
1192481486 X:71490054-71490076 AAGTAGGAGGGGAAAGTGGAGGG - Intronic
1192547620 X:72027025-72027047 GAGGAGAAGAGGAAAGTGGTTGG + Intergenic
1192580777 X:72279119-72279141 CTGCTGAGGGGTAAAGTGGATGG - Intronic
1193066523 X:77265791-77265813 CAGGAGAAGGAGAAGGTGAAGGG - Intergenic
1193365174 X:80623244-80623266 CTGGAGCTGGGGAGACTGGATGG - Intergenic
1193775453 X:85635631-85635653 CTGCAGAAGGGGAAAAGGAACGG + Intergenic
1193867787 X:86757714-86757736 CAGGAGGAGGAGAAAGTGAAGGG - Intronic
1194341922 X:92716072-92716094 CTGGAGAAGCTCAAACTGGACGG + Intergenic
1194391013 X:93318068-93318090 CTAGGAAAGGAGAAAGTGGAAGG + Intergenic
1194445873 X:93986702-93986724 CTGGAGCAGGGGATGCTGGATGG + Intergenic
1194818336 X:98473198-98473220 CTGTAAAAGGGGAAAATTGACGG + Intergenic
1194833645 X:98656495-98656517 CTGGAGAACGGGAATGGGAATGG + Intergenic
1194917306 X:99722141-99722163 CTGGAAAAGGGCAAAGTGGGAGG + Intergenic
1195811427 X:108835909-108835931 CTGGAAATGGAGATAGTGGATGG - Intergenic
1195943051 X:110180842-110180864 ATGGAGAAGGGAAGTGTGGAAGG - Intronic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196093624 X:111774635-111774657 CTGGAGAAGAGCAAAATGGAGGG - Exonic
1196346353 X:114664366-114664388 CTGGAGGTGGGGAAGGAGGAGGG - Intronic
1196754199 X:119143595-119143617 CTGGAGAAGAGGAAAGGGGGAGG - Intronic
1197417835 X:126196942-126196964 CAGGAGCAGGAGAGAGTGGAGGG - Intergenic
1197440112 X:126477130-126477152 CTGGAGAAAGAGAAGGTGAAGGG + Intergenic
1197516715 X:127441142-127441164 CTGGAGAAGGGGAACAAGTAAGG - Intergenic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198671139 X:139082332-139082354 CTGCAGATGGGGAAAGAGAAGGG - Intronic
1199860428 X:151796432-151796454 GTGAAGAAGAGGAAAGAGGAAGG - Intergenic
1200689120 Y:6288810-6288832 GTGGGGTAGGGGGAAGTGGAGGG - Intergenic
1201046153 Y:9885912-9885934 GTGGGGTAGGGGGAAGTGGAGGG + Intergenic
1201069260 Y:10129498-10129520 CTGGAGAAGGAGAAAATTGCTGG - Intergenic
1201071418 Y:10150373-10150395 CGGGAGAAGGGATTAGTGGAGGG + Intergenic
1201142403 Y:11039733-11039755 CTGGAGTGGGGTGAAGTGGAGGG - Intergenic
1201675940 Y:16584113-16584135 CTGTAGGAGGCCAAAGTGGAAGG - Intergenic
1201759311 Y:17519902-17519924 CTGGAGAAGGAGAAAATTGCTGG + Intergenic
1201842243 Y:18386088-18386110 CTGGAGAAGGAGAAAATTGCTGG - Intergenic
1202386715 Y:24333471-24333493 CTGGAGAAAAGGACAGTGAATGG - Intergenic
1202484070 Y:25336657-25336679 CTGGAGAAAAGGACAGTGAATGG + Intergenic