ID: 1059331473

View in Genome Browser
Species Human (GRCh38)
Location 9:113538334-113538356
Sequence GTGACCAACCCAGGATCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 84}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059331473_1059331485 22 Left 1059331473 9:113538334-113538356 CCCACTGATCCTGGGTTGGTCAC 0: 1
1: 0
2: 1
3: 12
4: 84
Right 1059331485 9:113538379-113538401 TCTTCATTGGGGTGGCCTCTGGG No data
1059331473_1059331480 11 Left 1059331473 9:113538334-113538356 CCCACTGATCCTGGGTTGGTCAC 0: 1
1: 0
2: 1
3: 12
4: 84
Right 1059331480 9:113538368-113538390 AGGCCGCTTCCTCTTCATTGGGG No data
1059331473_1059331479 10 Left 1059331473 9:113538334-113538356 CCCACTGATCCTGGGTTGGTCAC 0: 1
1: 0
2: 1
3: 12
4: 84
Right 1059331479 9:113538367-113538389 CAGGCCGCTTCCTCTTCATTGGG No data
1059331473_1059331476 -9 Left 1059331473 9:113538334-113538356 CCCACTGATCCTGGGTTGGTCAC 0: 1
1: 0
2: 1
3: 12
4: 84
Right 1059331476 9:113538348-113538370 GTTGGTCACAGTCAGAATCCAGG No data
1059331473_1059331482 14 Left 1059331473 9:113538334-113538356 CCCACTGATCCTGGGTTGGTCAC 0: 1
1: 0
2: 1
3: 12
4: 84
Right 1059331482 9:113538371-113538393 CCGCTTCCTCTTCATTGGGGTGG No data
1059331473_1059331478 9 Left 1059331473 9:113538334-113538356 CCCACTGATCCTGGGTTGGTCAC 0: 1
1: 0
2: 1
3: 12
4: 84
Right 1059331478 9:113538366-113538388 CCAGGCCGCTTCCTCTTCATTGG No data
1059331473_1059331484 21 Left 1059331473 9:113538334-113538356 CCCACTGATCCTGGGTTGGTCAC 0: 1
1: 0
2: 1
3: 12
4: 84
Right 1059331484 9:113538378-113538400 CTCTTCATTGGGGTGGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059331473 Original CRISPR GTGACCAACCCAGGATCAGT GGG (reversed) Intronic
902318284 1:15640643-15640665 GTAAGCAACCCAGGATGAGAAGG - Intronic
905953655 1:41974313-41974335 GTGCCCATCCTAGGAGCAGTTGG + Intronic
909039029 1:70628411-70628433 ATGGCCAACCCAGAATCAGCGGG - Intergenic
909708851 1:78620655-78620677 ATGACCAAATCAGGATCATTGGG + Intronic
912528826 1:110305392-110305414 GTCACCACCCCATTATCAGTAGG - Intergenic
915206479 1:154273861-154273883 GTCACCAGCCCAGGATCTTTGGG + Exonic
918984726 1:191609005-191609027 ATGGCCAACCCAGAATCAGTGGG - Intergenic
921810478 1:219506665-219506687 GTGTTAAACCTAGGATCAGTGGG - Intergenic
923861568 1:237897101-237897123 GTGTACAGCCCAGGATCAGTGGG - Intergenic
924458147 1:244234522-244234544 GTGACCCACCCAGGATCAGGTGG - Intergenic
1064903082 10:20315363-20315385 GAGACCAAGGCAGGATCAGAGGG - Intergenic
1074292578 10:112150364-112150386 GTGAAAAAGCCAGGATCATTGGG + Exonic
1074995758 10:118755531-118755553 GGGACCGACCCAAGAGCAGTCGG - Intergenic
1076140371 10:128073579-128073601 GAGACCAAGCCAGGACCACTAGG + Intronic
1086145713 11:83549210-83549232 GTGTCCAAGCCAGGCACAGTGGG - Intronic
1092089851 12:5795400-5795422 GTGAGCACCCCAGGAACAGGTGG + Intronic
1098141175 12:67451541-67451563 GTGACCCAGCCAGGGTCAGAAGG + Intergenic
1101512159 12:105403228-105403250 GTGCCCAAGCCAAGCTCAGTGGG - Intergenic
1102624969 12:114227582-114227604 GTTTCTAACCTAGGATCAGTGGG + Intergenic
1103618818 12:122173256-122173278 GTTACCAACCCAAGATGACTGGG - Intronic
1104597269 12:130128353-130128375 GTGACCAAGCCACGCTCAGCTGG - Intergenic
1111048783 13:82850988-82851010 GTGACAAACTCAAGATCAATAGG + Intergenic
1113628462 13:111863900-111863922 GTCACCGACCCAGGAGCAGCAGG + Intergenic
1119329122 14:73780789-73780811 GTTTCCTACCCAGGCTCAGTTGG - Intronic
1121488427 14:94339819-94339841 GTGAGCAAGCCAGGCACAGTTGG - Intergenic
1122615205 14:103012891-103012913 GTGTGTAACCCAGGAGCAGTAGG + Intronic
1130162597 15:81416129-81416151 GTGACCAGGTCAGGATCTGTTGG - Intergenic
1137469159 16:48739245-48739267 GTGACCCACCATGGATGAGTGGG + Intergenic
1142306346 16:89288058-89288080 GTGGCCGGCCCAGGAGCAGTGGG - Intronic
1144753021 17:17663130-17663152 GTGACCAACCCAGGGCCACCAGG + Intergenic
1150227761 17:63533163-63533185 GTGATCAACCCAGGATCTCTAGG - Intronic
1152713470 17:81886659-81886681 GTCACCAACCCAGCATCAGGGGG + Intergenic
1153545951 18:6204861-6204883 GAGACCATCCCAGGAGCTGTGGG - Intronic
1153595881 18:6724912-6724934 GTCACCACCCCAGGATCAGGAGG + Intergenic
1154068699 18:11132794-11132816 GTGACTGACCCAGAATCACTGGG + Intronic
1162918057 19:13884819-13884841 GTGACCAAGGCAGGAGCAGCAGG - Intronic
1162932864 19:13965999-13966021 GTCCCCAACCCAGGGTCACTGGG + Intronic
1163031354 19:14546115-14546137 GTGACCACCCCAGGTGCAGAAGG - Intronic
1163174622 19:15555803-15555825 GTGACTTACCCAAGATCATTCGG + Intergenic
925080603 2:1061160-1061182 GCGTCCAACCCAGGATCACGCGG - Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
925715033 2:6775995-6776017 GTGACCAACACAGCAGCGGTGGG + Intergenic
928438031 2:31268559-31268581 GTGACCAACCCAGGCACAGCTGG + Exonic
929659932 2:43774074-43774096 GTGACCAGCCTAGAATCAGGCGG - Exonic
930769082 2:55113788-55113810 CTGACCAGCCCAGAATCAGAAGG + Intergenic
933723154 2:85410723-85410745 GTGACTAACCCAGCAGCGGTGGG - Intronic
938366411 2:130737922-130737944 GAGACCTACCCAGGATCTCTCGG + Intergenic
939933466 2:148259477-148259499 ATGGCCGACCCAGAATCAGTGGG + Intronic
940266138 2:151841006-151841028 GTGACGAACACAGGATCAAGAGG - Intronic
942938404 2:181586673-181586695 GTTACCAACAGAGGAACAGTTGG - Intronic
942998226 2:182291390-182291412 GTGATTAACCCTGCATCAGTAGG - Intronic
945205877 2:207331788-207331810 GTAACCAGCCCAGGAGCAATTGG + Intergenic
1170859203 20:20087084-20087106 GTGCCCATCCCAGAAACAGTGGG + Intronic
1173235652 20:41243246-41243268 GCTACCAGCCCAGCATCAGTAGG + Intronic
1174522452 20:51142141-51142163 GGGGCCAACCCAAGATGAGTTGG + Intergenic
1174618942 20:51859234-51859256 GTGACCAATTCAGGAGCAGTTGG - Intergenic
1175551600 20:59821500-59821522 GGGTCCAACCAAGGAGCAGTAGG - Intronic
1175768811 20:61609931-61609953 GTGATCAAACCAGGATCATCGGG + Intronic
1178291492 21:31372458-31372480 GTGACCAACCCCTGCTCAGCCGG + Intronic
1179501529 21:41812377-41812399 GTGACATTCCCAGGATCAGGAGG + Intronic
1179635077 21:42703592-42703614 GGGACCCATCCAGGACCAGTGGG + Intronic
1184375185 22:44107574-44107596 GTAACCAACACAGGATTAGAGGG + Intronic
969247714 4:5946117-5946139 GTGACCACCCTAGGTTCAGAGGG - Intronic
969509828 4:7611459-7611481 GTGCCCAGCCCAGGAGCTGTTGG + Intronic
974531381 4:63112101-63112123 GTGATCAAACCAGGGTGAGTGGG + Intergenic
975810811 4:78167458-78167480 GTGAGCAATCCAGGATGGGTAGG + Intronic
976811451 4:89105028-89105050 ATAGCCAACCCAGGATCACTGGG - Intronic
991257923 5:64635798-64635820 GTTGCCAAACCAGGATAAGTTGG - Intergenic
994590268 5:101762298-101762320 ATGGCCTACCCAGGATCACTGGG + Intergenic
998060554 5:139115436-139115458 AAGACCAACCCAGGATTAGAGGG + Intronic
1001600546 5:172925548-172925570 GTGGCCACTCCAGGAGCAGTGGG - Intronic
1003660823 6:8059765-8059787 GTGACCAACACAAGACCAATTGG - Intronic
1009857738 6:69286001-69286023 GTGACAAACCCAGTATGAGTGGG - Intronic
1012626566 6:101411102-101411124 GTGATCAACCCAGAATCCTTAGG - Intronic
1013163951 6:107572959-107572981 GTGAGCAGCCCAGGATTCGTGGG - Intronic
1018290460 6:162287900-162287922 GTGACTAACCCAGCAGCAGATGG + Intronic
1023874976 7:44281959-44281981 GGGACCAGCCCAGGATGAGCTGG - Intronic
1024347159 7:48324750-48324772 GTGAGCATCCAAGGTTCAGTGGG - Intronic
1025258386 7:57400282-57400304 GTGTTCTACCCAGGGTCAGTGGG - Intergenic
1029106238 7:98178899-98178921 GTGACCAGCCCAGCATCACATGG + Intronic
1030128172 7:106174596-106174618 ATGGCCAACCCAACATCAGTGGG - Intergenic
1033617546 7:143031558-143031580 GTGACCAAATCAGGGTAAGTGGG - Intergenic
1035476307 7:159145776-159145798 GTGACCAACCCAGGAGAGCTCGG + Intergenic
1041163483 8:55069060-55069082 GTGACCAACCCACCATCTGAGGG + Intergenic
1045665909 8:104484321-104484343 CTGGCCAACCCAGATTCAGTAGG - Intergenic
1046657195 8:116907706-116907728 GTAACTAACCCAAGATCACTAGG + Intergenic
1048743471 8:137587787-137587809 GTGACCAGACCAGGATCAGCTGG - Intergenic
1051530427 9:18095877-18095899 ATGACCAACCCAGTAGCAGTAGG - Intergenic
1052189329 9:25639752-25639774 TTTACTAACACAGGATCAGTGGG - Intergenic
1057275918 9:93675892-93675914 GTGACCACCCCTGGCTCAGTGGG - Intronic
1058374993 9:104312571-104312593 GTGACGATCCCAGGCTCAGAAGG + Intergenic
1058530286 9:105899819-105899841 GGCACCGACCCAGTATCAGTAGG + Intergenic
1059331473 9:113538334-113538356 GTGACCAACCCAGGATCAGTGGG - Intronic
1061234849 9:129336440-129336462 GGGACTAACCCAAGATCACTGGG - Intergenic
1062281870 9:135755572-135755594 GGGACAAACTCAGGCTCAGTAGG + Intronic
1185948801 X:4407485-4407507 CTGACCATCTCAGGATTAGTAGG - Intergenic
1187371284 X:18709140-18709162 GTGAACAACTCAGCAGCAGTTGG + Intronic
1200270198 X:154675529-154675551 GTGACAAACCCAGGAGCACTGGG - Intronic