ID: 1059332022

View in Genome Browser
Species Human (GRCh38)
Location 9:113541669-113541691
Sequence GAGGCTTCTTCCTTCCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059332018_1059332022 -4 Left 1059332018 9:113541650-113541672 CCCAAGAGGAGAGGACTCAGAGG 0: 1
1: 0
2: 2
3: 42
4: 349
Right 1059332022 9:113541669-113541691 GAGGCTTCTTCCTTCCAAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 192
1059332020_1059332022 -5 Left 1059332020 9:113541651-113541673 CCAAGAGGAGAGGACTCAGAGGC 0: 1
1: 0
2: 3
3: 48
4: 480
Right 1059332022 9:113541669-113541691 GAGGCTTCTTCCTTCCAAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 192
1059332014_1059332022 30 Left 1059332014 9:113541616-113541638 CCTTGTGGGCATGCAGAGACTGG 0: 1
1: 0
2: 2
3: 18
4: 195
Right 1059332022 9:113541669-113541691 GAGGCTTCTTCCTTCCAAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059332022 Original CRISPR GAGGCTTCTTCCTTCCAAGG AGG Intronic
900344836 1:2205618-2205640 GAGCCTGCTTCGTTTCAAGGTGG + Intronic
901069417 1:6509717-6509739 TAGGCTTCTGCCTCCCAAGCTGG + Intronic
902227253 1:15004259-15004281 CAGTGTTCTTCCTTCCTAGGTGG + Intronic
902581885 1:17413023-17413045 GAGGTCTCTTCCTTTCATGGGGG - Intronic
902624647 1:17669582-17669604 GAGACTTCTGCCCACCAAGGTGG - Intronic
905282894 1:36860357-36860379 GAGGCTGCTTCCTTTCAAAAGGG + Intronic
906155811 1:43613316-43613338 GAGGCTTCCTTCCTCCCAGGAGG - Intronic
906860023 1:49349526-49349548 GCAGCTTCCTCCTTCCAAGAGGG + Intronic
907140485 1:52181506-52181528 GACGCTTCTCCCTTCCCAGACGG - Intronic
907801226 1:57767745-57767767 GAGGCTTCCTCTTCCCATGGTGG - Intronic
907960878 1:59279821-59279843 GAGACAGCTTCCTTCCGAGGTGG + Intergenic
911661168 1:100502999-100503021 GCTGCTTCTTACTTCCAGGGAGG - Intronic
914813583 1:151047367-151047389 TAAGCCTCTTCCATCCAAGGTGG - Exonic
916443523 1:164850908-164850930 GAGGCCTCTTCCAACCAAAGAGG + Exonic
916476897 1:165178168-165178190 AAGGCATCTTCTTTGCAAGGCGG + Intergenic
916910408 1:169340309-169340331 CAGGCATCTTCCTCACAAGGCGG - Intronic
917872200 1:179251906-179251928 CAGGTTTCTTCTATCCAAGGAGG - Intergenic
920190945 1:204193401-204193423 GGCACTTCTTCCTTCCATGGTGG + Intronic
920388462 1:205584069-205584091 GAGGCATCTTCCTTCTCAGGAGG - Exonic
921154614 1:212429438-212429460 GAGGCTTCTTTGTTTCACGGTGG - Intergenic
922350060 1:224727986-224728008 GAGGCTGCAACCTTCCAAGCAGG - Intronic
922654670 1:227371236-227371258 GAGGCTTATTTCTTGAAAGGAGG - Intergenic
924077716 1:240358601-240358623 AAGGCATCTTCTTTACAAGGTGG + Intronic
924938712 1:248794374-248794396 AAGTCTTCCTTCTTCCAAGGAGG + Intergenic
1064516214 10:16151632-16151654 GAGGATGCTTTCTTCCCAGGAGG - Intergenic
1068666799 10:59684919-59684941 GAGGCGGCTCCCTTCAAAGGAGG + Intronic
1068923074 10:62505641-62505663 ATGGCTTCCTTCTTCCAAGGTGG + Intronic
1070160819 10:73865800-73865822 GAGGCTCAGACCTTCCAAGGTGG + Intronic
1070634797 10:78116698-78116720 CAGGGTGCTTCCTTCCATGGAGG + Intergenic
1071160819 10:82743234-82743256 GATGCTCCTACCTTCCACGGAGG - Intronic
1074679254 10:115887410-115887432 GGGGCAGCTTCCTTCCTAGGTGG + Intronic
1074923592 10:118045970-118045992 GAGGCCTCCTCCTTCCAAACTGG + Exonic
1076089648 10:127671263-127671285 AAGGCTTCTTACTTTCCAGGTGG - Intergenic
1076090088 10:127677846-127677868 AAGGCTTCTTACTTTCCAGGTGG + Intergenic
1076911606 10:133392789-133392811 GAGGCTTCTGTCTTCCACGGAGG + Intronic
1077093271 11:789014-789036 GAGCATTCTCCCCTCCAAGGAGG + Intronic
1077133087 11:984307-984329 GGTGCTTCTTCCTTCTGAGGAGG + Intronic
1077866080 11:6222976-6222998 GAGGCATCCTACTTCCAAGATGG + Intronic
1081711287 11:45217656-45217678 GAGGCTGTTGCCTTCCAAGGAGG - Intronic
1084118466 11:67055492-67055514 GAGGATCCTTCCCTCCAAGTGGG + Intergenic
1085293038 11:75413754-75413776 GAGGGTTCTTGCCTCCAATGTGG - Intronic
1086109605 11:83185337-83185359 GAGGTTTCATCCTTCAAAAGGGG + Exonic
1086218207 11:84408633-84408655 GTGACTTCTTCCTACCAAGTTGG + Intronic
1086485728 11:87299305-87299327 CAGGCTTCTTCTTCACAAGGTGG + Intronic
1087066712 11:94034236-94034258 GATTCTTCTACCTTCTAAGGTGG + Intronic
1087170848 11:95049234-95049256 GAGGCTTCTGACTTCCCAGGGGG - Intergenic
1087940299 11:104088637-104088659 GAGCCATCTGCCTTCCCAGGAGG - Intronic
1089200275 11:116720573-116720595 GAGGGTTCTGTCTTCCTAGGAGG + Intergenic
1089993820 11:122885931-122885953 AAGTCTTCTTTCTTCAAAGGTGG - Exonic
1090635187 11:128686607-128686629 GAGGCTTCTCCCTCCCAGGCTGG + Intronic
1091135981 11:133189955-133189977 GATGCTTCATCCTTCCCTGGCGG + Intronic
1093713331 12:22352971-22352993 GAGGCTGCTTCCACTCAAGGTGG - Intronic
1096079730 12:48825382-48825404 GAGGCTGCTTCTCTCCAAAGGGG + Intronic
1096805896 12:54140991-54141013 GAGGGTGCATTCTTCCAAGGGGG - Intergenic
1097351358 12:58552885-58552907 GTCTCTTTTTCCTTCCAAGGTGG - Intronic
1097633151 12:62088684-62088706 GAGAATTCTTCCTTTGAAGGAGG + Intronic
1099175189 12:79413193-79413215 GTGGCTTCTTTCTTCAAAGGAGG - Intronic
1099630154 12:85132376-85132398 GTGGCTTCTTCCTGCTAGGGAGG - Intronic
1100876626 12:98968673-98968695 GAGGCCTCTTGGTTCCAAGTGGG + Intronic
1104048768 12:125182883-125182905 GAGGCTCCTTCCTTCCATCATGG + Intergenic
1104719796 12:131038971-131038993 TAGGCTTCCTCCTCCCTAGGGGG - Intronic
1106940334 13:34770988-34771010 CAGGCCTCTTCTTTACAAGGTGG + Intergenic
1111574034 13:90127052-90127074 CAGGCTTCTTCCCTCCATAGTGG - Intergenic
1113797410 13:113066486-113066508 GGGGCTTCTGCATTCCAAGCGGG + Intronic
1114228713 14:20761522-20761544 GAGGCCTCTTTCTTCCCAGATGG - Intergenic
1114327448 14:21603390-21603412 GAGGATAATTCTTTCCAAGGAGG - Intergenic
1114579768 14:23746857-23746879 TAGGCTTCCACCTTCCAAAGAGG - Intergenic
1115070480 14:29316716-29316738 GAGGCCTCTTCCATGCAAGGTGG - Intergenic
1117066276 14:52015482-52015504 GATGCTTCTTTCTTGCCAGGAGG + Intronic
1118366655 14:65102272-65102294 GGGGCTTCTTCCTTCCCGTGCGG - Intronic
1119178351 14:72586422-72586444 GAGGCTGCTTCCACCCATGGTGG - Intergenic
1120458248 14:84759721-84759743 GAGGATTCTTTCTTCCAATAGGG - Intergenic
1122951007 14:105044933-105044955 GTGGCTTCTTCATTTCCAGGAGG - Intergenic
1123794263 15:23755876-23755898 GAGGCTGCTTCCATTCATGGTGG + Intergenic
1125006038 15:34819340-34819362 GGGGCTTTTTCCTTGCAGGGAGG - Intergenic
1128302450 15:66575075-66575097 CAGGCTCCCTCCTTCCAAGATGG - Intergenic
1130379199 15:83357309-83357331 GTGGCTTCTTCCTGCCAGGGAGG - Intergenic
1131267363 15:90924721-90924743 GCTGCTTTTTGCTTCCAAGGTGG - Intergenic
1132101665 15:99027836-99027858 GAGGCTTCATCTTTCAAATGAGG - Intergenic
1132702159 16:1226532-1226554 GAAGCTTCTTCCTCCCCAGCAGG - Intergenic
1133149786 16:3818956-3818978 GAGGCTTCACCCTTGCACGGGGG + Intronic
1133505188 16:6404879-6404901 CAGGCTTCTTCCTTCCATATCGG - Intronic
1134006470 16:10821627-10821649 GAGGGTGCTTTCTTCCAAGGAGG - Intergenic
1135227971 16:20678071-20678093 AAGGCTTCTTCTTTAGAAGGTGG - Intronic
1137597241 16:49732840-49732862 CCAGCTGCTTCCTTCCAAGGCGG + Intronic
1138595040 16:58025457-58025479 GAGTCTTCATTCTTCCCAGGCGG + Intergenic
1138810714 16:60146817-60146839 GAGGGTTCTTCTATCCAATGTGG + Intergenic
1140755285 16:78060928-78060950 GAGGCTATCTCCTTCCAAGAGGG + Intronic
1143048354 17:4101017-4101039 GAGGCTCCTGCCATCCAAAGTGG - Intronic
1143340938 17:6210259-6210281 GAGGAGTCTTCCTTCAAAGGTGG + Intergenic
1144444552 17:15314877-15314899 GAGGCCTCTTCCTTCCAGCAGGG - Intronic
1147373178 17:40007955-40007977 CAGGCTTCTTGCTTCTCAGGAGG + Intergenic
1147885292 17:43680147-43680169 GAGGGCCCTTCCTACCAAGGTGG - Intergenic
1149298984 17:55286851-55286873 GCTGCTTCTTCCTTCCATGATGG + Intronic
1149301340 17:55307101-55307123 GTTTCTTCTTCCTTTCAAGGGGG + Intronic
1149601216 17:57894143-57894165 GGGGCTTCTTCCTGGCAAAGAGG - Intronic
1150531386 17:65986449-65986471 AATGCTTTTTCCTTCCATGGTGG + Intronic
1151514325 17:74582386-74582408 GAGGCTCCTTAATTCCTAGGTGG - Intronic
1152099482 17:78292635-78292657 CAGGCTTCTTGCTCCCAGGGAGG + Intergenic
1152424224 17:80210307-80210329 GAGGGTTCTTCCTTCCTGTGGGG - Exonic
1154453812 18:14502872-14502894 CAGGCTTCTTCGTTGCAAAGAGG - Intergenic
1157316123 18:46591615-46591637 GAGGATATTTCCTTTCAAGGAGG + Intronic
1159518085 18:69483499-69483521 GATGCTCATTCCTTCCAAAGAGG - Intronic
1164538522 19:29105308-29105330 GAAGCTGCTTCCCTACAAGGGGG - Intergenic
1164598971 19:29548565-29548587 GAGGCAGCCTCCTTGCAAGGTGG + Intronic
1164783723 19:30913101-30913123 GAGGCTTTTTCCCTCCAGAGGGG - Intergenic
1167316440 19:48766073-48766095 GGAGCTTCGTCCTTCCAAGAGGG + Intergenic
1167316805 19:48768455-48768477 GGAGCTTCGTCCTTCCAAGAGGG + Intergenic
925146070 2:1584315-1584337 GAGGCTTCCTTCTTCCAAGTCGG + Intergenic
928000218 2:27517407-27517429 AAGGCATCTTCTTCCCAAGGTGG + Intronic
929119106 2:38469243-38469265 CAGGCAGCTTCCTCCCAAGGTGG - Intergenic
930095115 2:47560908-47560930 GAGGCTTCTGCCTGGGAAGGGGG + Intronic
930753574 2:54954429-54954451 GAGGCTGCTGCCTTCCGAGGAGG - Intronic
932480290 2:72035073-72035095 GAGGTTTTCTCCATCCAAGGGGG + Intergenic
934892118 2:98079779-98079801 TAGGCTTCTTCCCTCCGAGGAGG - Intergenic
935008996 2:99113437-99113459 GAGGCCTGTTCCTTGCTAGGTGG - Intronic
937065108 2:119011741-119011763 GAGGCGTCTGTCTTCCGAGGTGG - Intergenic
937289178 2:120771751-120771773 GAGTCTTCTGCCTTCCAGAGGGG + Intronic
939516042 2:143169497-143169519 AAAGCTTCTTCCTACCTAGGAGG - Intronic
940111605 2:150161122-150161144 GTTGCTTCTTCCTTCCAACTCGG + Intergenic
941452701 2:165678682-165678704 CTGTGTTCTTCCTTCCAAGGTGG + Exonic
941817620 2:169813488-169813510 GAGGCTTGTTCCTCCAAATGTGG - Intronic
942707685 2:178795118-178795140 TAGCCCTCTTGCTTCCAAGGGGG + Exonic
945435286 2:209810565-209810587 GAGAATCCTTCCTTCCAAGAAGG - Intronic
947442314 2:230133891-230133913 GAGACAGCTTCCTTCCATGGAGG - Intergenic
947539078 2:230962301-230962323 GAGGGTTTTGCCTTCCAAGAGGG + Intergenic
947836881 2:233182201-233182223 CAGGCTTCTTCTGTCCATGGAGG + Intronic
948165180 2:235855847-235855869 GAGGCTACTGCATTCCCAGGGGG + Intronic
948488276 2:238295008-238295030 GAGCCTTCACCCTCCCAAGGAGG - Intergenic
1169853998 20:10083750-10083772 TAGGCTTCTTCCCATCAAGGTGG + Intergenic
1171972057 20:31570713-31570735 AAGGCTTCTTCCTTTCAGGGAGG + Exonic
1172257421 20:33531231-33531253 TATGCTTCTTCAGTCCAAGGTGG + Intronic
1176019404 20:62954801-62954823 TTGACTTCCTCCTTCCAAGGAGG + Intronic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1176430067 21:6569965-6569987 GATGCCTCCTCCTTCCAAGCTGG - Intergenic
1179436256 21:41364077-41364099 GAGGCTTCTGCCTTCGTCGGGGG + Intronic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1179705461 21:43177427-43177449 GATGCCTCCTCCTTCCAAGCTGG - Intergenic
1179942783 21:44650587-44650609 GGGGCTGGTTCCTTCCATGGTGG - Intronic
1179992140 21:44953618-44953640 GGGGCTTCTTCCTTTCCAGGTGG + Intronic
1182270370 22:29149531-29149553 GAGGCTCTTTCCTTCCATGAAGG + Intronic
1183529654 22:38346582-38346604 AAGGCTGCTTCCTTCCGAGTTGG + Intronic
1185419491 22:50727626-50727648 CAGGCCTCTTCCTTCCTAGATGG - Intergenic
949390822 3:3560168-3560190 GAGCCTTCTTCCTTGCATTGGGG + Intergenic
951165036 3:19475155-19475177 GAGGCATCATCCTTCCAATGGGG + Intronic
951844662 3:27072616-27072638 CAGGTTGCCTCCTTCCAAGGAGG - Intergenic
952203178 3:31151945-31151967 GAGACTTCTTCCTTCCACTTGGG - Intergenic
952401715 3:32969546-32969568 AAGGCTTCTTCTTTAGAAGGTGG - Intergenic
952752693 3:36838258-36838280 GAGGCTGCAGTCTTCCAAGGAGG - Intronic
958463949 3:94435025-94435047 GATACTTCTTCCTTAAAAGGAGG - Intergenic
960445647 3:117745921-117745943 GTGGCACATTCCTTCCAAGGGGG - Intergenic
962285147 3:134078994-134079016 GATGGTTCATCCTTCCAAGAGGG + Intronic
963120977 3:141777013-141777035 GAGGAAGCTTCCTTCCACGGAGG - Intergenic
965607403 3:170510815-170510837 GTGACTTTTTCCTTCCAAGGTGG - Intronic
965701875 3:171466282-171466304 AAGTCTTCTTCCTACCAGGGTGG + Intergenic
965867077 3:173217208-173217230 GAGAATTCTTCCTTCCACTGGGG - Intergenic
972346342 4:38195640-38195662 GATTCTTCTTCCTCTCAAGGTGG + Intergenic
974033407 4:56796189-56796211 GTGGCTCCTTCCTTGCAAAGGGG - Intergenic
976734167 4:88294121-88294143 GTGCCATCTTCCTTCCAGGGAGG + Intergenic
978454547 4:108873849-108873871 GAGTTTTCTTCCTTCAAAGACGG + Intronic
981748015 4:148069371-148069393 CTGGCTTCTGCCTTCCAGGGAGG + Intronic
986220618 5:5765695-5765717 GAAGCTTTTTCCTTACAAAGCGG - Intergenic
990431174 5:55737093-55737115 GAGCCTGTTTCCTTCCAAAGTGG + Intronic
990781267 5:59366026-59366048 GAGGCTTTTTCCCCCCAAGATGG + Intronic
991264014 5:64695643-64695665 GAGGCTTCTTCCACTCAAGAAGG + Exonic
993127428 5:83852380-83852402 AAGGCTTCAGGCTTCCAAGGTGG - Intergenic
993491698 5:88559610-88559632 GATGCTTTTTTCTTCCAAGATGG - Intergenic
996261425 5:121474592-121474614 AAGGCATCTTCCTTTCAAAGAGG + Intergenic
997811931 5:136979041-136979063 GATGCTCCTACCTTCCCAGGAGG + Intronic
1003304819 6:4916793-4916815 GATGCTTCCTAATTCCAAGGAGG + Intronic
1007135799 6:39520770-39520792 ACGGCTTCTTGCTTCCAAGGTGG + Intronic
1013086190 6:106859786-106859808 GAGGCAGCTTCCTTCCACAGAGG + Intergenic
1013173727 6:107660013-107660035 GCGGCTTCTTCCTGCCTGGGTGG - Exonic
1018422437 6:163651107-163651129 GAGGATTCTACTTTTCAAGGGGG + Intergenic
1018628999 6:165805912-165805934 GAGGATTCTTCCTTACAGGTTGG - Intronic
1021144158 7:17065041-17065063 GAGGCTCCTTGCTGGCAAGGTGG + Intergenic
1023945283 7:44797603-44797625 CAGGCCTCTTCCGACCAAGGTGG + Intronic
1029365602 7:100114227-100114249 GGGGCTTCATCCTTCCAGGGAGG - Exonic
1030995693 7:116356146-116356168 GAGGTTTCTTCTTTACCAGGTGG - Intronic
1031172676 7:118311349-118311371 AAGTCTTCTTCCTTCACAGGTGG + Intergenic
1031974847 7:128087061-128087083 GAGTCTTCCTCCTTCCAAAGGGG + Intronic
1032486338 7:132290248-132290270 GAGGCTTCTGGCTTCCAGGAAGG + Intronic
1033652844 7:143355316-143355338 GCGGATTCTTCCTTCCAGGATGG - Exonic
1034546513 7:151793281-151793303 GAAGCTCCTTCCTTCCCCGGCGG - Intronic
1036393523 8:8346609-8346631 GAGGCTTGTTCCTACGAATGAGG - Intronic
1036994091 8:13634175-13634197 GAAGCTTCTCCCTTCCAATCTGG + Intergenic
1038479421 8:27891644-27891666 GAGGCTTCTGCATCCCACGGGGG - Intronic
1040295926 8:46149046-46149068 GAGGCCTCTTCCATCCCAGAAGG - Intergenic
1040320026 8:46287728-46287750 GAGGCCTCTCCCTTCCCAGAAGG - Intergenic
1040320322 8:46291095-46291117 GAGGCCTCTCCCTTCCCAGAAGG - Intergenic
1041709016 8:60876249-60876271 CAGGTTTCCTCCTTCCCAGGAGG + Intergenic
1043230934 8:77800233-77800255 CAGGATTCTTCTTCCCAAGGTGG + Intergenic
1046849732 8:118958516-118958538 GAGGCTTTTTCTTGCCGAGGAGG - Intergenic
1050326499 9:4502785-4502807 CAGGCTTCTTTCTTGCAAAGTGG + Intronic
1053142818 9:35691486-35691508 GAGGCTGCCTTCTACCAAGGAGG + Intergenic
1053837054 9:42149891-42149913 GAGGTTTCTTCCTTTCTTGGAGG - Intergenic
1056978274 9:91281872-91281894 TAGGCTTCTTCCTTCTAACCTGG + Intronic
1058227897 9:102389231-102389253 GAGGTTTCATGCTTCCAAGTAGG + Intergenic
1059332022 9:113541669-113541691 GAGGCTTCTTCCTTCCAAGGAGG + Intronic
1060247259 9:121957277-121957299 CAGGGTTCTTCCTCCCATGGTGG - Intronic
1061306030 9:129733922-129733944 GTGGATTCTGCCTTCCCAGGGGG + Intergenic
1062362133 9:136193188-136193210 GAGCCCCCTTCCTTCCAGGGTGG - Intergenic
1062468186 9:136690743-136690765 GGGGCTCCTTCCTTCCAGGGAGG + Intergenic
1187194863 X:17073130-17073152 CAGGCTGCTTCATACCAAGGAGG + Intronic
1187276755 X:17823039-17823061 GAGGCCTCTTCTTTACAAGTCGG - Intronic
1187363975 X:18651595-18651617 GAGACGTCTGCCTTCCAATGGGG + Intronic
1187391400 X:18888653-18888675 GAGAATTCTGCCTTCCAAAGTGG - Intergenic
1189341926 X:40211072-40211094 GGGGCTCCTTACTTCCAAGACGG + Intergenic
1195845235 X:109220549-109220571 GCCTCTTCTTCCTTCCAAGATGG - Intergenic
1196183939 X:112725469-112725491 GCTGCTTTTTCCTTCCAAGATGG + Intergenic
1196522442 X:116689481-116689503 GAGTCGTCTTTCTTCCATGGAGG + Intergenic
1198677175 X:139143724-139143746 AAGACTGCTTCCCTCCAAGGTGG + Intronic
1199776353 X:151015339-151015361 GAGGCTCCTGCCTTCCAGGGAGG - Intergenic
1202102505 Y:21325085-21325107 TACCCTTCTTCCTTCCAAGAGGG - Intergenic