ID: 1059335015

View in Genome Browser
Species Human (GRCh38)
Location 9:113563633-113563655
Sequence GAAGGTTCCTAGGCCCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059335010_1059335015 4 Left 1059335010 9:113563606-113563628 CCAGCAGGATGACAGCCTTCCAG 0: 1
1: 1
2: 1
3: 27
4: 197
Right 1059335015 9:113563633-113563655 GAAGGTTCCTAGGCCCTGCAAGG No data
1059335008_1059335015 19 Left 1059335008 9:113563591-113563613 CCTGCTTTTCAGGAGCCAGCAGG 0: 1
1: 1
2: 0
3: 41
4: 332
Right 1059335015 9:113563633-113563655 GAAGGTTCCTAGGCCCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059335015 Original CRISPR GAAGGTTCCTAGGCCCTGCA AGG Intronic
No off target data available for this crispr