ID: 1059335959

View in Genome Browser
Species Human (GRCh38)
Location 9:113568638-113568660
Sequence GCTGCAGCCCAAGCCGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059335954_1059335959 13 Left 1059335954 9:113568602-113568624 CCCCAGGCGCCTCTGGGCAGGAG 0: 1
1: 0
2: 4
3: 32
4: 308
Right 1059335959 9:113568638-113568660 GCTGCAGCCCAAGCCGAAGCTGG No data
1059335946_1059335959 26 Left 1059335946 9:113568589-113568611 CCCCCAGCCTGTTCCCCAGGCGC 0: 1
1: 0
2: 3
3: 48
4: 365
Right 1059335959 9:113568638-113568660 GCTGCAGCCCAAGCCGAAGCTGG No data
1059335957_1059335959 4 Left 1059335957 9:113568611-113568633 CCTCTGGGCAGGAGCCTTCGCAT 0: 1
1: 0
2: 1
3: 8
4: 126
Right 1059335959 9:113568638-113568660 GCTGCAGCCCAAGCCGAAGCTGG No data
1059335951_1059335959 19 Left 1059335951 9:113568596-113568618 CCTGTTCCCCAGGCGCCTCTGGG 0: 1
1: 0
2: 2
3: 27
4: 302
Right 1059335959 9:113568638-113568660 GCTGCAGCCCAAGCCGAAGCTGG No data
1059335949_1059335959 23 Left 1059335949 9:113568592-113568614 CCAGCCTGTTCCCCAGGCGCCTC 0: 1
1: 1
2: 2
3: 33
4: 364
Right 1059335959 9:113568638-113568660 GCTGCAGCCCAAGCCGAAGCTGG No data
1059335947_1059335959 25 Left 1059335947 9:113568590-113568612 CCCCAGCCTGTTCCCCAGGCGCC 0: 1
1: 0
2: 3
3: 33
4: 414
Right 1059335959 9:113568638-113568660 GCTGCAGCCCAAGCCGAAGCTGG No data
1059335956_1059335959 11 Left 1059335956 9:113568604-113568626 CCAGGCGCCTCTGGGCAGGAGCC 0: 1
1: 0
2: 3
3: 38
4: 310
Right 1059335959 9:113568638-113568660 GCTGCAGCCCAAGCCGAAGCTGG No data
1059335955_1059335959 12 Left 1059335955 9:113568603-113568625 CCCAGGCGCCTCTGGGCAGGAGC 0: 1
1: 0
2: 0
3: 19
4: 230
Right 1059335959 9:113568638-113568660 GCTGCAGCCCAAGCCGAAGCTGG No data
1059335948_1059335959 24 Left 1059335948 9:113568591-113568613 CCCAGCCTGTTCCCCAGGCGCCT 0: 1
1: 1
2: 1
3: 27
4: 250
Right 1059335959 9:113568638-113568660 GCTGCAGCCCAAGCCGAAGCTGG No data
1059335958_1059335959 -10 Left 1059335958 9:113568625-113568647 CCTTCGCATGCAAGCTGCAGCCC 0: 1
1: 0
2: 2
3: 10
4: 123
Right 1059335959 9:113568638-113568660 GCTGCAGCCCAAGCCGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059335959 Original CRISPR GCTGCAGCCCAAGCCGAAGC TGG Intronic
No off target data available for this crispr